Incidental Mutation 'R8468:Sestd1'
ID 656901
Institutional Source Beutler Lab
Gene Symbol Sestd1
Ensembl Gene ENSMUSG00000042272
Gene Name SEC14 and spectrin domains 1
Synonyms 1500031J16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8468 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 77180340-77280592 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 77191746 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 534 (T534S)
Ref Sequence ENSEMBL: ENSMUSP00000099721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102659] [ENSMUST00000102660]
AlphaFold Q80UK0
Predicted Effect probably benign
Transcript: ENSMUST00000102659
AA Change: T534S

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099720
Gene: ENSMUSG00000042272
AA Change: T534S

DomainStartEndE-ValueType
Pfam:CRAL_TRIO_2 13 154 2.9e-13 PFAM
SPEC 275 378 3.27e0 SMART
Blast:SPEC 381 494 1e-51 BLAST
SPEC 500 602 5.79e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102660
AA Change: T534S

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099721
Gene: ENSMUSG00000042272
AA Change: T534S

DomainStartEndE-ValueType
Pfam:CRAL_TRIO_2 27 154 1.5e-9 PFAM
SPEC 275 378 3.27e0 SMART
Blast:SPEC 381 494 1e-51 BLAST
SPEC 500 602 5.79e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (36/36)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, short and curly tail, absent genital tubercle, blind-end colon, hydronephrosis, absent bladder and more rounded posterior contour. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A G 16: 85,795,556 W655R possibly damaging Het
Adamts3 C T 5: 89,694,768 A748T probably benign Het
Ano1 A C 7: 144,655,620 F248C probably damaging Het
Ap2b1 T A 11: 83,351,065 L628Q probably damaging Het
BC035947 C A 1: 78,498,330 A522S probably damaging Het
Bdp1 A G 13: 100,060,568 V1103A probably benign Het
Cd248 T A 19: 5,069,882 I586N possibly damaging Het
Dnah9 C A 11: 65,831,730 M4428I probably benign Het
Epha5 T C 5: 84,142,416 probably null Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fastkd2 T A 1: 63,731,764 L93Q probably benign Het
Gm6665 T C 18: 31,820,400 D5G possibly damaging Het
Gphn T C 12: 78,226,827 V17A probably benign Het
Gpr85 A T 6: 13,836,296 L203H probably damaging Het
Grk6 A G 13: 55,451,385 Y166C probably damaging Het
Ints3 A G 3: 90,406,253 V356A probably damaging Het
Krt33b G A 11: 100,029,789 R13C probably damaging Het
Lgals3 A G 14: 47,381,647 I146V possibly damaging Het
Lrp1 G A 10: 127,558,650 R2565C probably damaging Het
Miip G T 4: 147,861,471 D325E probably damaging Het
Naaladl1 T A 19: 6,108,585 V249E probably damaging Het
Nfxl1 C T 5: 72,518,205 R811K possibly damaging Het
Olfr1145 T C 2: 87,810,738 I306T possibly damaging Het
Olfr676 A T 7: 105,035,746 I183F probably damaging Het
Olfr681 A G 7: 105,121,478 D7G probably benign Het
Olfr701 A G 7: 106,818,839 Y252C possibly damaging Het
Olfr822 C T 10: 130,074,434 T8I probably benign Het
Olfr994 T A 2: 85,430,178 Y217F probably damaging Het
Pkd2l2 A G 18: 34,427,411 D357G possibly damaging Het
Ppp1r36 A G 12: 76,436,205 Y189C probably damaging Het
Rev3l A G 10: 39,827,991 E2011G probably damaging Het
Sfmbt1 G A 14: 30,773,984 A75T probably benign Het
Smarcc2 G A 10: 128,484,393 R882H probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Speg C T 1: 75,431,309 A3216V probably damaging Het
Vmn1r12 A G 6: 57,159,385 T112A probably benign Het
Zfp937 T G 2: 150,238,714 D221E probably benign Het
Other mutations in Sestd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Sestd1 APN 2 77212452 missense possibly damaging 0.53
IGL00725:Sestd1 APN 2 77188522 missense probably benign
IGL01317:Sestd1 APN 2 77192545 missense possibly damaging 0.73
IGL01649:Sestd1 APN 2 77199045 missense probably damaging 1.00
IGL01953:Sestd1 APN 2 77212469 missense possibly damaging 0.91
IGL02439:Sestd1 APN 2 77196830 missense possibly damaging 0.49
R0408:Sestd1 UTSW 2 77191793 missense probably damaging 1.00
R0562:Sestd1 UTSW 2 77230722 missense probably benign 0.10
R0788:Sestd1 UTSW 2 77191716 missense probably damaging 1.00
R1518:Sestd1 UTSW 2 77241632 missense probably damaging 1.00
R2119:Sestd1 UTSW 2 77212523 missense probably benign 0.00
R4659:Sestd1 UTSW 2 77212499 missense probably null 0.75
R5698:Sestd1 UTSW 2 77218168 missense possibly damaging 0.90
R5927:Sestd1 UTSW 2 77187159 missense probably benign 0.00
R7046:Sestd1 UTSW 2 77192566 missense probably benign 0.32
R8361:Sestd1 UTSW 2 77187228 missense probably benign 0.15
R8962:Sestd1 UTSW 2 77212364 missense probably benign
R9406:Sestd1 UTSW 2 77245077 start gained probably benign
X0023:Sestd1 UTSW 2 77199032 missense probably benign 0.05
X0057:Sestd1 UTSW 2 77218193 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CACCAAATGGCCTTTTCTTAGC -3'
(R):5'- AGTTCATAGAGCATGGCATCG -3'

Sequencing Primer
(F):5'- AGCTCTGTGTAGCCAAACTG -3'
(R):5'- TCATAGAGCATGGCATCGAATAAATG -3'
Posted On 2021-01-18