Mutagenetix > Incidental Mutation

Incidental Mutation 'R8468:Adamts3'

656908

Institutional Source

Beutler Lab

Gene Symbol

Adamts3

Ensembl Gene

ENSMUSG00000043635

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3

Synonyms

6330442E02Rik, 1100001H14Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8468 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

89677087-89883334 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 89694768 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 748 (A748T)

Ref Sequence

ENSEMBL: ENSMUSP00000058552 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159]

AlphaFold

E9Q287

Predicted Effect

probably benign
Transcript: ENSMUST00000061427
AA Change: A748T

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: A748T

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	42	201	5.1e-40	PFAM
Pfam:Reprolysin_5	254	439	5.4e-15	PFAM
Pfam:Reprolysin_4	256	454	1.9e-10	PFAM
Pfam:Reprolysin	257	460	3.6e-22	PFAM
Pfam:Reprolysin_2	274	451	7.7e-13	PFAM
Pfam:Reprolysin_3	278	409	1.5e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	827	3e-34	PFAM
TSP1	848	905	4.35e-2	SMART
TSP1	908	967	4.95e-2	SMART
TSP1	969	1016	6.58e-5	SMART
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1157	1177	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163159

SMART Domains

Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	43	201	1.5e-40	PFAM
Pfam:Reprolysin_5	254	439	2.2e-15	PFAM
Pfam:Reprolysin_4	256	454	7.7e-11	PFAM
Pfam:Reprolysin	257	460	3.7e-21	PFAM
Pfam:Reprolysin_2	274	451	4.3e-14	PFAM
Pfam:Reprolysin_3	278	409	1.3e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	828	3.6e-28	PFAM
TSP1	849	906	4.35e-2	SMART
TSP1	909	968	4.95e-2	SMART
TSP1	970	1017	6.58e-5	SMART
low complexity region	1115	1129	N/A	INTRINSIC
low complexity region	1158	1178	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (36/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts1	A	G	16: 85,795,556	W655R	possibly damaging	Het
Ano1	A	C	7: 144,655,620	F248C	probably damaging	Het
Ap2b1	T	A	11: 83,351,065	L628Q	probably damaging	Het
BC035947	C	A	1: 78,498,330	A522S	probably damaging	Het
Bdp1	A	G	13: 100,060,568	V1103A	probably benign	Het
Cd248	T	A	19: 5,069,882	I586N	possibly damaging	Het
Dnah9	C	A	11: 65,831,730	M4428I	probably benign	Het
Epha5	T	C	5: 84,142,416		probably null	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fastkd2	T	A	1: 63,731,764	L93Q	probably benign	Het
Gm6665	T	C	18: 31,820,400	D5G	possibly damaging	Het
Gphn	T	C	12: 78,226,827	V17A	probably benign	Het
Gpr85	A	T	6: 13,836,296	L203H	probably damaging	Het
Grk6	A	G	13: 55,451,385	Y166C	probably damaging	Het
Ints3	A	G	3: 90,406,253	V356A	probably damaging	Het
Krt33b	G	A	11: 100,029,789	R13C	probably damaging	Het
Lgals3	A	G	14: 47,381,647	I146V	possibly damaging	Het
Lrp1	G	A	10: 127,558,650	R2565C	probably damaging	Het
Miip	G	T	4: 147,861,471	D325E	probably damaging	Het
Naaladl1	T	A	19: 6,108,585	V249E	probably damaging	Het
Nfxl1	C	T	5: 72,518,205	R811K	possibly damaging	Het
Olfr1145	T	C	2: 87,810,738	I306T	possibly damaging	Het
Olfr676	A	T	7: 105,035,746	I183F	probably damaging	Het
Olfr681	A	G	7: 105,121,478	D7G	probably benign	Het
Olfr701	A	G	7: 106,818,839	Y252C	possibly damaging	Het
Olfr822	C	T	10: 130,074,434	T8I	probably benign	Het
Olfr994	T	A	2: 85,430,178	Y217F	probably damaging	Het
Pkd2l2	A	G	18: 34,427,411	D357G	possibly damaging	Het
Ppp1r36	A	G	12: 76,436,205	Y189C	probably damaging	Het
Rev3l	A	G	10: 39,827,991	E2011G	probably damaging	Het
Sestd1	T	A	2: 77,191,746	T534S	probably benign	Het
Sfmbt1	G	A	14: 30,773,984	A75T	probably benign	Het
Smarcc2	G	A	10: 128,484,393	R882H	probably benign	Het
Son	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	16: 91,656,691		probably benign	Het
Speg	C	T	1: 75,431,309	A3216V	probably damaging	Het
Vmn1r12	A	G	6: 57,159,385	T112A	probably benign	Het
Zfp937	T	G	2: 150,238,714	D221E	probably benign	Het

Other mutations in Adamts3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Adamts3	APN	5	89861325	missense	probably damaging	1.00
IGL00340:Adamts3	APN	5	89701666	missense	probably damaging	1.00
IGL00923:Adamts3	APN	5	89684376	missense	probably benign	0.06
IGL01420:Adamts3	APN	5	89703057	missense	possibly damaging	0.57
IGL01522:Adamts3	APN	5	89702943	missense	probably benign	0.14
IGL01676:Adamts3	APN	5	89677754	missense	probably benign	0.00
IGL01676:Adamts3	APN	5	89881543	missense	possibly damaging	0.54
IGL01678:Adamts3	APN	5	89707856	missense	probably damaging	1.00
IGL01936:Adamts3	APN	5	89861423	missense	probably benign	0.00
IGL01956:Adamts3	APN	5	89677911	missense	probably damaging	0.99
IGL02342:Adamts3	APN	5	89691473	splice site	probably null
IGL02415:Adamts3	APN	5	89706647	splice site	probably null
IGL03261:Adamts3	APN	5	89882897	utr 5 prime	probably benign
IGL03301:Adamts3	APN	5	89707404	missense	probably damaging	1.00
R0041:Adamts3	UTSW	5	89684467	missense	probably benign
R0079:Adamts3	UTSW	5	89693053	missense	probably benign	0.00
R0096:Adamts3	UTSW	5	89701717	nonsense	probably null
R0096:Adamts3	UTSW	5	89701717	nonsense	probably null
R0477:Adamts3	UTSW	5	89684507	missense	probably benign
R0605:Adamts3	UTSW	5	89861475	missense	possibly damaging	0.96
R1036:Adamts3	UTSW	5	89696093	splice site	probably benign
R1462:Adamts3	UTSW	5	89861349	missense	probably benign	0.17
R1462:Adamts3	UTSW	5	89861349	missense	probably benign	0.17
R1621:Adamts3	UTSW	5	89721701	missense	probably damaging	1.00
R1799:Adamts3	UTSW	5	89775421	missense	probably benign	0.00
R2163:Adamts3	UTSW	5	89708718	missense	probably damaging	0.99
R2412:Adamts3	UTSW	5	89701771	missense	probably damaging	0.99
R2420:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2421:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2422:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2921:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2922:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2923:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R3402:Adamts3	UTSW	5	89701733	missense	probably benign	0.04
R3431:Adamts3	UTSW	5	89707453	splice site	probably benign
R3432:Adamts3	UTSW	5	89707453	splice site	probably benign
R3813:Adamts3	UTSW	5	89677926	missense	possibly damaging	0.67
R3816:Adamts3	UTSW	5	89705264	missense	probably damaging	0.99
R3905:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3906:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3907:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3908:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R4557:Adamts3	UTSW	5	89700487	missense	probably benign	0.03
R4684:Adamts3	UTSW	5	89703007	missense	probably damaging	0.98
R4844:Adamts3	UTSW	5	89677816	missense	probably damaging	0.99
R4925:Adamts3	UTSW	5	89684323	missense	probably benign	0.01
R5097:Adamts3	UTSW	5	89693050	missense	probably damaging	0.97
R5100:Adamts3	UTSW	5	89708643	missense	probably damaging	1.00
R5237:Adamts3	UTSW	5	89775377	missense	probably benign
R5265:Adamts3	UTSW	5	89861552	missense	possibly damaging	0.91
R5322:Adamts3	UTSW	5	89707300	splice site	probably null
R5413:Adamts3	UTSW	5	89708767	missense	probably damaging	1.00
R5459:Adamts3	UTSW	5	89691473	splice site	probably null
R5738:Adamts3	UTSW	5	89708668	missense	probably damaging	1.00
R5979:Adamts3	UTSW	5	89861669	missense	probably damaging	0.96
R5992:Adamts3	UTSW	5	89691335	missense	probably damaging	1.00
R6364:Adamts3	UTSW	5	89721814	missense	possibly damaging	0.92
R6572:Adamts3	UTSW	5	89861609	missense	possibly damaging	0.87
R7098:Adamts3	UTSW	5	89861495	missense	probably damaging	1.00
R7172:Adamts3	UTSW	5	89883001	start gained	probably benign
R7263:Adamts3	UTSW	5	89677742	missense	probably benign	0.03
R7401:Adamts3	UTSW	5	89707450	critical splice acceptor site	probably null
R7599:Adamts3	UTSW	5	89861397	missense	probably benign	0.00
R7829:Adamts3	UTSW	5	89861490	missense	probably damaging	1.00
R7835:Adamts3	UTSW	5	89700440	missense	possibly damaging	0.70
R7892:Adamts3	UTSW	5	89861429	missense	probably benign	0.10
R8021:Adamts3	UTSW	5	89683184	missense	possibly damaging	0.47
R8289:Adamts3	UTSW	5	89775423	missense	possibly damaging	0.89
R8350:Adamts3	UTSW	5	89702956	missense	probably damaging	1.00
R8827:Adamts3	UTSW	5	89691465	missense	probably benign	0.03
R8864:Adamts3	UTSW	5	89707122	intron	probably benign
R8906:Adamts3	UTSW	5	89677716	missense	probably damaging	0.98
R9000:Adamts3	UTSW	5	89706711	missense	probably benign	0.17
R9005:Adamts3	UTSW	5	89677834	missense	probably benign	0.08
R9378:Adamts3	UTSW	5	89700410	nonsense	probably null
R9505:Adamts3	UTSW	5	89707892	missense	probably damaging	1.00
R9516:Adamts3	UTSW	5	89686891	missense	probably damaging	1.00
X0064:Adamts3	UTSW	5	89703042	missense	possibly damaging	0.75
Z1088:Adamts3	UTSW	5	89684449	missense	probably damaging	0.99
Z1176:Adamts3	UTSW	5	89775351	missense	not run
Z1177:Adamts3	UTSW	5	89707864	nonsense	probably null
Z1177:Adamts3	UTSW	5	89775351	missense	not run

Predicted Primers

PCR Primer
(F):5'- CCTCATCCTCACATGTATATGTATGAC -3'
(R):5'- GCAAGATGTCTTCAGGCTGTG -3'

Sequencing Primer
(F):5'- aCTCCATGTGTAGTGTCTT -3'
(R):5'- GAGATGCTCCGTTCCATTTATG -3'

Posted On

2021-01-18