Incidental Mutation 'R8468:Fan1'
ID 656911
Institutional Source Beutler Lab
Gene Symbol Fan1
Ensembl Gene ENSMUSG00000033458
Gene Name FANCD2/FANCI-associated nuclease 1
Synonyms Mtmr15, 6030441H18Rik
MMRRC Submission 067912-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8468 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 63996506-64023843 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 64022234 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 340 (N340Y)
Ref Sequence ENSEMBL: ENSMUSP00000130012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032735] [ENSMUST00000163289]
AlphaFold Q69ZT1
Predicted Effect probably benign
Transcript: ENSMUST00000032735
SMART Domains Protein: ENSMUSP00000032735
Gene: ENSMUSG00000030521

DomainStartEndE-ValueType
Pfam:Mpp10 20 654 6.9e-217 PFAM
low complexity region 666 671 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163289
AA Change: N340Y

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130012
Gene: ENSMUSG00000033458
AA Change: N340Y

DomainStartEndE-ValueType
SCOP:d1ihga1 600 737 5e-5 SMART
Blast:VRR_NUC 834 867 2e-12 BLAST
VRR_NUC 896 1011 1.99e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206778
Meta Mutation Damage Score 0.1011 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene plays a role in DNA interstrand cross-link repair and encodes a protein with 5' flap endonuclease and 5'-3' exonuclease activity. Mutations in this gene cause karyomegalic interstitial nephritis. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for mutations in this gene display renal tubular karyomegaly with polyploidy and defects in interstrand cross-link DNA repair. Some homozygous mice also display hepatocyte karyomegaly and liver dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A G 16: 85,592,444 (GRCm39) W655R possibly damaging Het
Adamts3 C T 5: 89,842,627 (GRCm39) A748T probably benign Het
Ano1 A C 7: 144,209,357 (GRCm39) F248C probably damaging Het
Ap2b1 T A 11: 83,241,891 (GRCm39) L628Q probably damaging Het
BC035947 C A 1: 78,474,967 (GRCm39) A522S probably damaging Het
Bdp1 A G 13: 100,197,076 (GRCm39) V1103A probably benign Het
Cd248 T A 19: 5,119,910 (GRCm39) I586N possibly damaging Het
Dnah9 C A 11: 65,722,556 (GRCm39) M4428I probably benign Het
Epha5 T C 5: 84,290,275 (GRCm39) probably null Het
Fastkd2 T A 1: 63,770,923 (GRCm39) L93Q probably benign Het
Gm6665 T C 18: 31,953,453 (GRCm39) D5G possibly damaging Het
Gphn T C 12: 78,273,601 (GRCm39) V17A probably benign Het
Gpr85 A T 6: 13,836,295 (GRCm39) L203H probably damaging Het
Grk6 A G 13: 55,599,198 (GRCm39) Y166C probably damaging Het
Ints3 A G 3: 90,313,560 (GRCm39) V356A probably damaging Het
Krt33b G A 11: 99,920,615 (GRCm39) R13C probably damaging Het
Lgals3 A G 14: 47,619,104 (GRCm39) I146V possibly damaging Het
Lrp1 G A 10: 127,394,519 (GRCm39) R2565C probably damaging Het
Miip G T 4: 147,945,928 (GRCm39) D325E probably damaging Het
Naaladl1 T A 19: 6,158,615 (GRCm39) V249E probably damaging Het
Nfxl1 C T 5: 72,675,548 (GRCm39) R811K possibly damaging Het
Or12e10 T C 2: 87,641,082 (GRCm39) I306T possibly damaging Het
Or2ag2b A G 7: 106,418,046 (GRCm39) Y252C possibly damaging Het
Or52e7 A T 7: 104,684,953 (GRCm39) I183F probably damaging Het
Or56a3b A G 7: 104,770,685 (GRCm39) D7G probably benign Het
Or5ak24 T A 2: 85,260,522 (GRCm39) Y217F probably damaging Het
Or6c69c C T 10: 129,910,303 (GRCm39) T8I probably benign Het
Pkd2l2 A G 18: 34,560,464 (GRCm39) D357G possibly damaging Het
Ppp1r36 A G 12: 76,482,979 (GRCm39) Y189C probably damaging Het
Rev3l A G 10: 39,703,987 (GRCm39) E2011G probably damaging Het
Sestd1 T A 2: 77,022,090 (GRCm39) T534S probably benign Het
Sfmbt1 G A 14: 30,495,941 (GRCm39) A75T probably benign Het
Smarcc2 G A 10: 128,320,262 (GRCm39) R882H probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,453,579 (GRCm39) probably benign Het
Speg C T 1: 75,407,953 (GRCm39) A3216V probably damaging Het
Vmn1r12 A G 6: 57,136,370 (GRCm39) T112A probably benign Het
Zfp937 T G 2: 150,080,634 (GRCm39) D221E probably benign Het
Other mutations in Fan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01648:Fan1 APN 7 64,022,297 (GRCm39) missense probably damaging 0.96
IGL01752:Fan1 APN 7 64,022,542 (GRCm39) missense probably benign 0.00
IGL01971:Fan1 APN 7 64,003,459 (GRCm39) missense probably damaging 0.98
IGL02043:Fan1 APN 7 64,021,367 (GRCm39) splice site probably null
IGL02542:Fan1 APN 7 64,014,408 (GRCm39) missense probably damaging 1.00
IGL02731:Fan1 APN 7 64,022,741 (GRCm39) missense possibly damaging 0.86
IGL03111:Fan1 APN 7 63,999,816 (GRCm39) missense possibly damaging 0.67
hitched UTSW 7 64,014,377 (GRCm39) missense probably damaging 1.00
stitched UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R0270:Fan1 UTSW 7 63,998,619 (GRCm39) missense probably benign 0.26
R0632:Fan1 UTSW 7 64,012,947 (GRCm39) missense possibly damaging 0.50
R1714:Fan1 UTSW 7 64,016,435 (GRCm39) missense probably benign 0.29
R1750:Fan1 UTSW 7 64,022,761 (GRCm39) missense probably benign 0.14
R1822:Fan1 UTSW 7 64,022,554 (GRCm39) missense probably benign 0.00
R2031:Fan1 UTSW 7 64,004,172 (GRCm39) missense probably damaging 0.98
R2107:Fan1 UTSW 7 64,016,536 (GRCm39) missense probably damaging 1.00
R2126:Fan1 UTSW 7 63,996,636 (GRCm39) missense probably damaging 1.00
R2869:Fan1 UTSW 7 64,012,938 (GRCm39) missense probably benign 0.16
R2869:Fan1 UTSW 7 64,012,938 (GRCm39) missense probably benign 0.16
R2870:Fan1 UTSW 7 64,012,938 (GRCm39) missense probably benign 0.16
R2870:Fan1 UTSW 7 64,012,938 (GRCm39) missense probably benign 0.16
R2871:Fan1 UTSW 7 64,012,938 (GRCm39) missense probably benign 0.16
R2871:Fan1 UTSW 7 64,012,938 (GRCm39) missense probably benign 0.16
R2873:Fan1 UTSW 7 64,012,938 (GRCm39) missense probably benign 0.16
R3849:Fan1 UTSW 7 64,022,119 (GRCm39) missense probably damaging 1.00
R3850:Fan1 UTSW 7 64,022,119 (GRCm39) missense probably damaging 1.00
R3949:Fan1 UTSW 7 64,021,292 (GRCm39) nonsense probably null
R4007:Fan1 UTSW 7 64,016,309 (GRCm39) missense probably damaging 1.00
R4490:Fan1 UTSW 7 64,018,928 (GRCm39) missense possibly damaging 0.84
R4623:Fan1 UTSW 7 64,023,301 (GRCm39) nonsense probably null
R4918:Fan1 UTSW 7 64,023,286 (GRCm39) utr 5 prime probably benign
R5328:Fan1 UTSW 7 64,004,217 (GRCm39) missense probably damaging 1.00
R5691:Fan1 UTSW 7 64,004,118 (GRCm39) splice site probably null
R5902:Fan1 UTSW 7 64,023,070 (GRCm39) splice site probably null
R5905:Fan1 UTSW 7 64,003,399 (GRCm39) missense probably benign 0.00
R6126:Fan1 UTSW 7 64,014,318 (GRCm39) nonsense probably null
R6195:Fan1 UTSW 7 64,004,119 (GRCm39) missense probably damaging 1.00
R6233:Fan1 UTSW 7 64,004,119 (GRCm39) missense probably damaging 1.00
R6405:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6434:Fan1 UTSW 7 64,004,129 (GRCm39) missense probably damaging 0.99
R6460:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6469:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6471:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6473:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6696:Fan1 UTSW 7 63,999,826 (GRCm39) missense probably damaging 1.00
R6708:Fan1 UTSW 7 64,022,554 (GRCm39) missense probably benign 0.00
R6713:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6714:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6749:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6841:Fan1 UTSW 7 64,014,377 (GRCm39) missense probably damaging 1.00
R6858:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6859:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6860:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6925:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6927:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6936:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6938:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6939:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R7040:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R7120:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R7290:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R7292:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R7459:Fan1 UTSW 7 63,998,714 (GRCm39) missense probably damaging 0.99
R7460:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R7464:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R7465:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R7465:Fan1 UTSW 7 64,003,386 (GRCm39) missense probably benign 0.30
R7608:Fan1 UTSW 7 64,003,979 (GRCm39) splice site probably null
R7624:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R7629:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R7682:Fan1 UTSW 7 64,022,512 (GRCm39) missense probably benign 0.06
R7731:Fan1 UTSW 7 64,022,444 (GRCm39) missense probably benign 0.17
R7863:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8054:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8055:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8057:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8058:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8101:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8241:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8262:Fan1 UTSW 7 64,023,054 (GRCm39) missense probably benign 0.02
R8274:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8275:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8276:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8285:Fan1 UTSW 7 64,016,348 (GRCm39) missense probably damaging 0.96
R8318:Fan1 UTSW 7 63,999,803 (GRCm39) missense probably damaging 1.00
R8402:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8466:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8799:Fan1 UTSW 7 64,016,406 (GRCm39) missense probably damaging 0.99
R8821:Fan1 UTSW 7 64,004,249 (GRCm39) missense probably damaging 1.00
R9030:Fan1 UTSW 7 64,022,761 (GRCm39) missense probably benign 0.14
R9181:Fan1 UTSW 7 64,016,400 (GRCm39) missense probably damaging 0.98
R9525:Fan1 UTSW 7 64,022,007 (GRCm39) critical splice donor site probably null
R9564:Fan1 UTSW 7 63,999,240 (GRCm39) missense possibly damaging 0.65
R9565:Fan1 UTSW 7 63,999,240 (GRCm39) missense possibly damaging 0.65
R9796:Fan1 UTSW 7 64,022,278 (GRCm39) missense probably benign 0.09
X0025:Fan1 UTSW 7 64,022,583 (GRCm39) missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCTTCTCCTGCTCATCGAAGAG -3'
(R):5'- AACACGAAATCCTCTCCGGG -3'

Sequencing Primer
(F):5'- TCATCGAAGAGCTTCATGTCC -3'
(R):5'- TCTCCGGGAGACACTCTTGTAAAG -3'
Posted On 2021-01-18