Incidental Mutation 'R8468:Olfr676'
ID 656912
Institutional Source Beutler Lab
Gene Symbol Olfr676
Ensembl Gene ENSMUSG00000073915
Gene Name olfactory receptor 676
Synonyms MOR32-1, GA_x6K02T2PBJ9-7664016-7664969
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock # R8468 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 105032698-105037750 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 105035746 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 183 (I183F)
Ref Sequence ENSEMBL: ENSMUSP00000151474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098162] [ENSMUST00000219602]
AlphaFold Q8VGZ9
Predicted Effect probably damaging
Transcript: ENSMUST00000098162
AA Change: I183F

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095765
Gene: ENSMUSG00000073915
AA Change: I183F

DomainStartEndE-ValueType
Pfam:7tm_4 41 317 3e-113 PFAM
Pfam:7TM_GPCR_Srsx 45 316 4.5e-7 PFAM
Pfam:7tm_1 51 301 1.5e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000219602
AA Change: I183F

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A G 16: 85,795,556 W655R possibly damaging Het
Adamts3 C T 5: 89,694,768 A748T probably benign Het
Ano1 A C 7: 144,655,620 F248C probably damaging Het
Ap2b1 T A 11: 83,351,065 L628Q probably damaging Het
BC035947 C A 1: 78,498,330 A522S probably damaging Het
Bdp1 A G 13: 100,060,568 V1103A probably benign Het
Cd248 T A 19: 5,069,882 I586N possibly damaging Het
Dnah9 C A 11: 65,831,730 M4428I probably benign Het
Epha5 T C 5: 84,142,416 probably null Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fastkd2 T A 1: 63,731,764 L93Q probably benign Het
Gm6665 T C 18: 31,820,400 D5G possibly damaging Het
Gphn T C 12: 78,226,827 V17A probably benign Het
Gpr85 A T 6: 13,836,296 L203H probably damaging Het
Grk6 A G 13: 55,451,385 Y166C probably damaging Het
Ints3 A G 3: 90,406,253 V356A probably damaging Het
Krt33b G A 11: 100,029,789 R13C probably damaging Het
Lgals3 A G 14: 47,381,647 I146V possibly damaging Het
Lrp1 G A 10: 127,558,650 R2565C probably damaging Het
Miip G T 4: 147,861,471 D325E probably damaging Het
Naaladl1 T A 19: 6,108,585 V249E probably damaging Het
Nfxl1 C T 5: 72,518,205 R811K possibly damaging Het
Olfr1145 T C 2: 87,810,738 I306T possibly damaging Het
Olfr681 A G 7: 105,121,478 D7G probably benign Het
Olfr701 A G 7: 106,818,839 Y252C possibly damaging Het
Olfr822 C T 10: 130,074,434 T8I probably benign Het
Olfr994 T A 2: 85,430,178 Y217F probably damaging Het
Pkd2l2 A G 18: 34,427,411 D357G possibly damaging Het
Ppp1r36 A G 12: 76,436,205 Y189C probably damaging Het
Rev3l A G 10: 39,827,991 E2011G probably damaging Het
Sestd1 T A 2: 77,191,746 T534S probably benign Het
Sfmbt1 G A 14: 30,773,984 A75T probably benign Het
Smarcc2 G A 10: 128,484,393 R882H probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Speg C T 1: 75,431,309 A3216V probably damaging Het
Vmn1r12 A G 6: 57,159,385 T112A probably benign Het
Zfp937 T G 2: 150,238,714 D221E probably benign Het
Other mutations in Olfr676
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02034:Olfr676 APN 7 105035390 missense probably benign
IGL02244:Olfr676 APN 7 105035945 missense probably damaging 1.00
IGL03493:Olfr676 APN 7 105035944 missense probably damaging 1.00
R1181:Olfr676 UTSW 7 105035814 missense probably damaging 1.00
R1223:Olfr676 UTSW 7 105035566 missense probably benign 0.01
R1460:Olfr676 UTSW 7 105035708 missense possibly damaging 0.80
R1768:Olfr676 UTSW 7 105035950 missense probably benign 0.00
R2256:Olfr676 UTSW 7 105035819 missense probably benign 0.00
R2257:Olfr676 UTSW 7 105035819 missense probably benign 0.00
R3846:Olfr676 UTSW 7 105035689 missense probably benign 0.40
R4486:Olfr676 UTSW 7 105035303 missense probably benign 0.00
R4488:Olfr676 UTSW 7 105035303 missense probably benign 0.00
R4489:Olfr676 UTSW 7 105035303 missense probably benign 0.00
R4598:Olfr676 UTSW 7 105036073 missense probably benign 0.19
R4599:Olfr676 UTSW 7 105036073 missense probably benign 0.00
R4701:Olfr676 UTSW 7 105035591 missense probably damaging 1.00
R4855:Olfr676 UTSW 7 105035651 missense probably damaging 0.99
R5083:Olfr676 UTSW 7 105035411 missense probably damaging 1.00
R5743:Olfr676 UTSW 7 105036156 splice site probably null
R5798:Olfr676 UTSW 7 105036137 missense probably benign 0.00
R6279:Olfr676 UTSW 7 105035671 missense probably benign 0.25
R6300:Olfr676 UTSW 7 105035671 missense probably benign 0.25
R7400:Olfr676 UTSW 7 105035210 missense probably benign
R7672:Olfr676 UTSW 7 105035543 missense probably damaging 1.00
R7698:Olfr676 UTSW 7 105035907 missense probably benign 0.01
R9297:Olfr676 UTSW 7 105035623 missense probably damaging 1.00
R9318:Olfr676 UTSW 7 105035623 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGGAGAGCATCGTACTCC -3'
(R):5'- GGGAGCTACACGTATTAAGAGC -3'

Sequencing Primer
(F):5'- ATCGTACTCCTCGCCATGGG -3'
(R):5'- CCTTTAGGCGAGCATCTTGAGAAG -3'
Posted On 2021-01-18