Mutagenetix > Incidental Mutation

Incidental Mutation 'R8468:Olfr676'

656912

Institutional Source

Beutler Lab

Gene Symbol

Olfr676

Ensembl Gene

ENSMUSG00000073915

Gene Name

olfactory receptor 676

Synonyms

MOR32-1, GA_x6K02T2PBJ9-7664016-7664969

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.064) question?

Stock #

R8468 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

105032698-105037750 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 105035746 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 183 (I183F)

Ref Sequence

ENSEMBL: ENSMUSP00000151474 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098162] [ENSMUST00000219602]

AlphaFold

Q8VGZ9

Predicted Effect

probably damaging
Transcript: ENSMUST00000098162
AA Change: I183F

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000095765
Gene: ENSMUSG00000073915
AA Change: I183F

Domain	Start	End	E-Value	Type
Pfam:7tm_4	41	317	3e-113	PFAM
Pfam:7TM_GPCR_Srsx	45	316	4.5e-7	PFAM
Pfam:7tm_1	51	301	1.5e-15	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000219602
AA Change: I183F

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (36/36)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts1	A	G	16: 85,795,556	W655R	possibly damaging	Het
Adamts3	C	T	5: 89,694,768	A748T	probably benign	Het
Ano1	A	C	7: 144,655,620	F248C	probably damaging	Het
Ap2b1	T	A	11: 83,351,065	L628Q	probably damaging	Het
BC035947	C	A	1: 78,498,330	A522S	probably damaging	Het
Bdp1	A	G	13: 100,060,568	V1103A	probably benign	Het
Cd248	T	A	19: 5,069,882	I586N	possibly damaging	Het
Dnah9	C	A	11: 65,831,730	M4428I	probably benign	Het
Epha5	T	C	5: 84,142,416		probably null	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fastkd2	T	A	1: 63,731,764	L93Q	probably benign	Het
Gm6665	T	C	18: 31,820,400	D5G	possibly damaging	Het
Gphn	T	C	12: 78,226,827	V17A	probably benign	Het
Gpr85	A	T	6: 13,836,296	L203H	probably damaging	Het
Grk6	A	G	13: 55,451,385	Y166C	probably damaging	Het
Ints3	A	G	3: 90,406,253	V356A	probably damaging	Het
Krt33b	G	A	11: 100,029,789	R13C	probably damaging	Het
Lgals3	A	G	14: 47,381,647	I146V	possibly damaging	Het
Lrp1	G	A	10: 127,558,650	R2565C	probably damaging	Het
Miip	G	T	4: 147,861,471	D325E	probably damaging	Het
Naaladl1	T	A	19: 6,108,585	V249E	probably damaging	Het
Nfxl1	C	T	5: 72,518,205	R811K	possibly damaging	Het
Olfr1145	T	C	2: 87,810,738	I306T	possibly damaging	Het
Olfr681	A	G	7: 105,121,478	D7G	probably benign	Het
Olfr701	A	G	7: 106,818,839	Y252C	possibly damaging	Het
Olfr822	C	T	10: 130,074,434	T8I	probably benign	Het
Olfr994	T	A	2: 85,430,178	Y217F	probably damaging	Het
Pkd2l2	A	G	18: 34,427,411	D357G	possibly damaging	Het
Ppp1r36	A	G	12: 76,436,205	Y189C	probably damaging	Het
Rev3l	A	G	10: 39,827,991	E2011G	probably damaging	Het
Sestd1	T	A	2: 77,191,746	T534S	probably benign	Het
Sfmbt1	G	A	14: 30,773,984	A75T	probably benign	Het
Smarcc2	G	A	10: 128,484,393	R882H	probably benign	Het
Son	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	16: 91,656,691		probably benign	Het
Speg	C	T	1: 75,431,309	A3216V	probably damaging	Het
Vmn1r12	A	G	6: 57,159,385	T112A	probably benign	Het
Zfp937	T	G	2: 150,238,714	D221E	probably benign	Het

Other mutations in Olfr676

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02034:Olfr676	APN	7	105035390	missense	probably benign
IGL02244:Olfr676	APN	7	105035945	missense	probably damaging	1.00
IGL03493:Olfr676	APN	7	105035944	missense	probably damaging	1.00
R1181:Olfr676	UTSW	7	105035814	missense	probably damaging	1.00
R1223:Olfr676	UTSW	7	105035566	missense	probably benign	0.01
R1460:Olfr676	UTSW	7	105035708	missense	possibly damaging	0.80
R1768:Olfr676	UTSW	7	105035950	missense	probably benign	0.00
R2256:Olfr676	UTSW	7	105035819	missense	probably benign	0.00
R2257:Olfr676	UTSW	7	105035819	missense	probably benign	0.00
R3846:Olfr676	UTSW	7	105035689	missense	probably benign	0.40
R4486:Olfr676	UTSW	7	105035303	missense	probably benign	0.00
R4488:Olfr676	UTSW	7	105035303	missense	probably benign	0.00
R4489:Olfr676	UTSW	7	105035303	missense	probably benign	0.00
R4598:Olfr676	UTSW	7	105036073	missense	probably benign	0.19
R4599:Olfr676	UTSW	7	105036073	missense	probably benign	0.00
R4701:Olfr676	UTSW	7	105035591	missense	probably damaging	1.00
R4855:Olfr676	UTSW	7	105035651	missense	probably damaging	0.99
R5083:Olfr676	UTSW	7	105035411	missense	probably damaging	1.00
R5743:Olfr676	UTSW	7	105036156	splice site	probably null
R5798:Olfr676	UTSW	7	105036137	missense	probably benign	0.00
R6279:Olfr676	UTSW	7	105035671	missense	probably benign	0.25
R6300:Olfr676	UTSW	7	105035671	missense	probably benign	0.25
R7400:Olfr676	UTSW	7	105035210	missense	probably benign
R7672:Olfr676	UTSW	7	105035543	missense	probably damaging	1.00
R7698:Olfr676	UTSW	7	105035907	missense	probably benign	0.01
R9297:Olfr676	UTSW	7	105035623	missense	probably damaging	1.00
R9318:Olfr676	UTSW	7	105035623	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATGGAGAGCATCGTACTCC -3'
(R):5'- GGGAGCTACACGTATTAAGAGC -3'

Sequencing Primer
(F):5'- ATCGTACTCCTCGCCATGGG -3'
(R):5'- CCTTTAGGCGAGCATCTTGAGAAG -3'

Posted On

2021-01-18