Incidental Mutation 'R8468:Ano1'
ID 656915
Institutional Source Beutler Lab
Gene Symbol Ano1
Ensembl Gene ENSMUSG00000031075
Gene Name anoctamin 1, calcium activated chloride channel
Synonyms Tmem16a
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8468 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 144588549-144751974 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 144655620 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Cysteine at position 248 (F248C)
Ref Sequence ENSEMBL: ENSMUSP00000120306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033393] [ENSMUST00000118556] [ENSMUST00000121758] [ENSMUST00000131731] [ENSMUST00000155175]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000033393
AA Change: F224C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033393
Gene: ENSMUSG00000031075
AA Change: F224C

DomainStartEndE-ValueType
low complexity region 129 147 N/A INTRINSIC
Pfam:Anoctamin 320 898 1.3e-149 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118556
AA Change: F282C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113899
Gene: ENSMUSG00000031075
AA Change: F282C

DomainStartEndE-ValueType
Pfam:Anoct_dimer 112 375 5.5e-83 PFAM
Pfam:Anoctamin 378 955 6.7e-140 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121758
AA Change: F281C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112616
Gene: ENSMUSG00000031075
AA Change: F281C

DomainStartEndE-ValueType
Pfam:Anoct_dimer 54 317 7.1e-83 PFAM
Pfam:Anoctamin 320 901 2.2e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131731
AA Change: F224C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118206
Gene: ENSMUSG00000031075
AA Change: F224C

DomainStartEndE-ValueType
low complexity region 129 147 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000119653
Gene: ENSMUSG00000031075
AA Change: F89C

DomainStartEndE-ValueType
Pfam:Anoct_dimer 2 205 4.4e-64 PFAM
Pfam:Anoctamin 208 335 3e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155175
AA Change: F248C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120306
Gene: ENSMUSG00000031075
AA Change: F248C

DomainStartEndE-ValueType
low complexity region 153 171 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (36/36)
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele exhibit postnatal death associated with aerophagia, slow postnatal weight gain, cyanosis, and abnormal tracheal morphology. Mice homozygous for a different knock-out allele exhibit proteinuria and intracellular endosomal vesicles in PTE cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A G 16: 85,795,556 W655R possibly damaging Het
Adamts3 C T 5: 89,694,768 A748T probably benign Het
Ap2b1 T A 11: 83,351,065 L628Q probably damaging Het
BC035947 C A 1: 78,498,330 A522S probably damaging Het
Bdp1 A G 13: 100,060,568 V1103A probably benign Het
Cd248 T A 19: 5,069,882 I586N possibly damaging Het
Dnah9 C A 11: 65,831,730 M4428I probably benign Het
Epha5 T C 5: 84,142,416 probably null Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fastkd2 T A 1: 63,731,764 L93Q probably benign Het
Gm6665 T C 18: 31,820,400 D5G possibly damaging Het
Gphn T C 12: 78,226,827 V17A probably benign Het
Gpr85 A T 6: 13,836,296 L203H probably damaging Het
Grk6 A G 13: 55,451,385 Y166C probably damaging Het
Ints3 A G 3: 90,406,253 V356A probably damaging Het
Krt33b G A 11: 100,029,789 R13C probably damaging Het
Lgals3 A G 14: 47,381,647 I146V possibly damaging Het
Lrp1 G A 10: 127,558,650 R2565C probably damaging Het
Miip G T 4: 147,861,471 D325E probably damaging Het
Naaladl1 T A 19: 6,108,585 V249E probably damaging Het
Nfxl1 C T 5: 72,518,205 R811K possibly damaging Het
Olfr1145 T C 2: 87,810,738 I306T possibly damaging Het
Olfr676 A T 7: 105,035,746 I183F probably damaging Het
Olfr681 A G 7: 105,121,478 D7G probably benign Het
Olfr701 A G 7: 106,818,839 Y252C possibly damaging Het
Olfr822 C T 10: 130,074,434 T8I probably benign Het
Olfr994 T A 2: 85,430,178 Y217F probably damaging Het
Pkd2l2 A G 18: 34,427,411 D357G possibly damaging Het
Ppp1r36 A G 12: 76,436,205 Y189C probably damaging Het
Rev3l A G 10: 39,827,991 E2011G probably damaging Het
Sestd1 T A 2: 77,191,746 T534S probably benign Het
Sfmbt1 G A 14: 30,773,984 A75T probably benign Het
Smarcc2 G A 10: 128,484,393 R882H probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Speg C T 1: 75,431,309 A3216V probably damaging Het
Vmn1r12 A G 6: 57,159,385 T112A probably benign Het
Zfp937 T G 2: 150,238,714 D221E probably benign Het
Other mutations in Ano1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Ano1 APN 7 144638513 missense probably damaging 1.00
IGL00754:Ano1 APN 7 144597231 missense probably damaging 0.98
IGL00780:Ano1 APN 7 144655630 missense probably damaging 0.99
IGL00918:Ano1 APN 7 144644752 splice site probably benign
IGL01112:Ano1 APN 7 144637145 missense possibly damaging 0.52
IGL01285:Ano1 APN 7 144644742 missense probably benign 0.00
IGL01285:Ano1 APN 7 144595538 missense probably damaging 0.98
IGL01308:Ano1 APN 7 144595498 missense probably damaging 0.99
IGL01407:Ano1 APN 7 144637111 missense probably benign 0.22
IGL01672:Ano1 APN 7 144655675 missense probably damaging 0.96
IGL01920:Ano1 APN 7 144611454 splice site probably benign
IGL01926:Ano1 APN 7 144610875 missense possibly damaging 0.94
IGL02164:Ano1 APN 7 144637181 missense possibly damaging 0.91
IGL02190:Ano1 APN 7 144618883 missense probably benign 0.41
IGL02214:Ano1 APN 7 144655708 missense possibly damaging 0.80
IGL02299:Ano1 APN 7 144590075 missense possibly damaging 0.80
IGL02567:Ano1 APN 7 144611625 missense probably damaging 1.00
IGL03131:Ano1 APN 7 144603585 missense possibly damaging 0.90
IGL03291:Ano1 APN 7 144621675 missense probably damaging 1.00
IGL03299:Ano1 APN 7 144654256 missense probably damaging 1.00
IGL03394:Ano1 APN 7 144595439 splice site probably null
PIT4434001:Ano1 UTSW 7 144610895 missense probably benign 0.28
R0502:Ano1 UTSW 7 144597215 missense probably damaging 1.00
R0595:Ano1 UTSW 7 144590153 missense possibly damaging 0.94
R0732:Ano1 UTSW 7 144619488 critical splice acceptor site probably null
R0970:Ano1 UTSW 7 144595571 missense probably benign 0.02
R0988:Ano1 UTSW 7 144633653 missense possibly damaging 0.94
R1074:Ano1 UTSW 7 144611680 missense probably damaging 0.98
R1301:Ano1 UTSW 7 144633689 missense possibly damaging 0.60
R1528:Ano1 UTSW 7 144595566 missense probably damaging 1.00
R2018:Ano1 UTSW 7 144654250 missense probably damaging 1.00
R2056:Ano1 UTSW 7 144648052 missense probably damaging 1.00
R2057:Ano1 UTSW 7 144648052 missense probably damaging 1.00
R2058:Ano1 UTSW 7 144648052 missense probably damaging 1.00
R2059:Ano1 UTSW 7 144611390 missense probably damaging 1.00
R2860:Ano1 UTSW 7 144590012 missense probably damaging 1.00
R2861:Ano1 UTSW 7 144590012 missense probably damaging 1.00
R3770:Ano1 UTSW 7 144595569 missense probably damaging 1.00
R3970:Ano1 UTSW 7 144607963 missense probably benign 0.00
R4179:Ano1 UTSW 7 144650505 missense probably damaging 1.00
R4489:Ano1 UTSW 7 144611742 missense probably benign 0.00
R4678:Ano1 UTSW 7 144669552 missense probably benign 0.01
R4915:Ano1 UTSW 7 144611375 missense possibly damaging 0.69
R5114:Ano1 UTSW 7 144657083 missense possibly damaging 0.71
R5362:Ano1 UTSW 7 144648600 unclassified probably benign
R5364:Ano1 UTSW 7 144637204 missense probably damaging 1.00
R5366:Ano1 UTSW 7 144654209 missense possibly damaging 0.85
R5387:Ano1 UTSW 7 144648619 missense probably benign
R5762:Ano1 UTSW 7 144648037 missense probably damaging 0.99
R5857:Ano1 UTSW 7 144637103 missense probably benign 0.02
R6091:Ano1 UTSW 7 144669434 missense probably benign 0.12
R6093:Ano1 UTSW 7 144611377 missense possibly damaging 0.72
R6177:Ano1 UTSW 7 144678741 missense possibly damaging 0.79
R6246:Ano1 UTSW 7 144633725 missense possibly damaging 0.82
R6274:Ano1 UTSW 7 144618863 missense probably benign 0.01
R6323:Ano1 UTSW 7 144611686 missense possibly damaging 0.95
R6574:Ano1 UTSW 7 144607916 critical splice donor site probably null
R6782:Ano1 UTSW 7 144621687 missense probably damaging 1.00
R6880:Ano1 UTSW 7 144644742 missense probably benign 0.00
R6909:Ano1 UTSW 7 144655731 missense probably damaging 0.96
R7066:Ano1 UTSW 7 144637086 missense probably benign 0.35
R7073:Ano1 UTSW 7 144638552 missense probably damaging 0.96
R7146:Ano1 UTSW 7 144655656 missense probably benign 0.00
R7420:Ano1 UTSW 7 144655641 missense probably benign 0.00
R7874:Ano1 UTSW 7 144621724 missense probably damaging 1.00
R8867:Ano1 UTSW 7 144669660 missense possibly damaging 0.66
R8923:Ano1 UTSW 7 144650551 missense possibly damaging 0.61
R9215:Ano1 UTSW 7 144595605 missense probably damaging 1.00
R9281:Ano1 UTSW 7 144595581 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCATATGGAACCAGGGCTC -3'
(R):5'- AGAGCAGCTGATTTCCCCAC -3'

Sequencing Primer
(F):5'- TAGACCTATCTAGCCAGGGC -3'
(R):5'- ACCTGGTCTTGCCCACAG -3'
Posted On 2021-01-18