Incidental Mutation 'R8468:Ap2b1'
ID 656921
Institutional Source Beutler Lab
Gene Symbol Ap2b1
Ensembl Gene ENSMUSG00000035152
Gene Name adaptor-related protein complex 2, beta 1 subunit
Synonyms 1300012O03Rik
MMRRC Submission 067912-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8468 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 83189850-83295861 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 83241891 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 628 (L628Q)
Ref Sequence ENSEMBL: ENSMUSP00000018875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018875] [ENSMUST00000065692] [ENSMUST00000176430] [ENSMUST00000176523]
AlphaFold Q9DBG3
Predicted Effect probably damaging
Transcript: ENSMUST00000018875
AA Change: L628Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018875
Gene: ENSMUSG00000035152
AA Change: L628Q

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 2.6e-173 PFAM
Pfam:HEAT_2 88 157 3.7e-8 PFAM
Pfam:Cnd1 99 268 2.1e-40 PFAM
Pfam:HEAT_2 124 219 1.4e-9 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 654 675 N/A INTRINSIC
Alpha_adaptinC2 721 831 2.94e-18 SMART
B2-adapt-app_C 840 950 9.93e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000065692
AA Change: L628Q

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070714
Gene: ENSMUSG00000035152
AA Change: L628Q

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 4.2e-173 PFAM
Pfam:HEAT_2 88 157 2.7e-8 PFAM
Pfam:Cnd1 99 268 1.5e-37 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
Alpha_adaptinC2 707 817 2.94e-18 SMART
B2-adapt-app_C 826 936 9.93e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176430
AA Change: L628Q

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134779
Gene: ENSMUSG00000035152
AA Change: L628Q

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 4e-173 PFAM
Pfam:HEAT_2 88 157 2.8e-8 PFAM
Pfam:Cnd1 99 268 1.5e-37 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 654 675 N/A INTRINSIC
Alpha_adaptinC2 721 831 2.94e-18 SMART
B2-adapt-app_C 840 936 7.22e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176523
AA Change: L590Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135445
Gene: ENSMUSG00000035152
AA Change: L590Q

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 95 1.1e-26 PFAM
Pfam:Cnd1 69 230 1.5e-26 PFAM
Pfam:HEAT_2 85 182 5.1e-9 PFAM
Pfam:Adaptin_N 90 496 4e-125 PFAM
low complexity region 587 605 N/A INTRINSIC
low complexity region 616 637 N/A INTRINSIC
Alpha_adaptinC2 683 793 2.94e-18 SMART
B2-adapt-app_C 802 912 9.93e-56 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (36/36)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A G 16: 85,592,444 (GRCm39) W655R possibly damaging Het
Adamts3 C T 5: 89,842,627 (GRCm39) A748T probably benign Het
Ano1 A C 7: 144,209,357 (GRCm39) F248C probably damaging Het
BC035947 C A 1: 78,474,967 (GRCm39) A522S probably damaging Het
Bdp1 A G 13: 100,197,076 (GRCm39) V1103A probably benign Het
Cd248 T A 19: 5,119,910 (GRCm39) I586N possibly damaging Het
Dnah9 C A 11: 65,722,556 (GRCm39) M4428I probably benign Het
Epha5 T C 5: 84,290,275 (GRCm39) probably null Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Fastkd2 T A 1: 63,770,923 (GRCm39) L93Q probably benign Het
Gm6665 T C 18: 31,953,453 (GRCm39) D5G possibly damaging Het
Gphn T C 12: 78,273,601 (GRCm39) V17A probably benign Het
Gpr85 A T 6: 13,836,295 (GRCm39) L203H probably damaging Het
Grk6 A G 13: 55,599,198 (GRCm39) Y166C probably damaging Het
Ints3 A G 3: 90,313,560 (GRCm39) V356A probably damaging Het
Krt33b G A 11: 99,920,615 (GRCm39) R13C probably damaging Het
Lgals3 A G 14: 47,619,104 (GRCm39) I146V possibly damaging Het
Lrp1 G A 10: 127,394,519 (GRCm39) R2565C probably damaging Het
Miip G T 4: 147,945,928 (GRCm39) D325E probably damaging Het
Naaladl1 T A 19: 6,158,615 (GRCm39) V249E probably damaging Het
Nfxl1 C T 5: 72,675,548 (GRCm39) R811K possibly damaging Het
Or12e10 T C 2: 87,641,082 (GRCm39) I306T possibly damaging Het
Or2ag2b A G 7: 106,418,046 (GRCm39) Y252C possibly damaging Het
Or52e7 A T 7: 104,684,953 (GRCm39) I183F probably damaging Het
Or56a3b A G 7: 104,770,685 (GRCm39) D7G probably benign Het
Or5ak24 T A 2: 85,260,522 (GRCm39) Y217F probably damaging Het
Or6c69c C T 10: 129,910,303 (GRCm39) T8I probably benign Het
Pkd2l2 A G 18: 34,560,464 (GRCm39) D357G possibly damaging Het
Ppp1r36 A G 12: 76,482,979 (GRCm39) Y189C probably damaging Het
Rev3l A G 10: 39,703,987 (GRCm39) E2011G probably damaging Het
Sestd1 T A 2: 77,022,090 (GRCm39) T534S probably benign Het
Sfmbt1 G A 14: 30,495,941 (GRCm39) A75T probably benign Het
Smarcc2 G A 10: 128,320,262 (GRCm39) R882H probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,453,579 (GRCm39) probably benign Het
Speg C T 1: 75,407,953 (GRCm39) A3216V probably damaging Het
Vmn1r12 A G 6: 57,136,370 (GRCm39) T112A probably benign Het
Zfp937 T G 2: 150,080,634 (GRCm39) D221E probably benign Het
Other mutations in Ap2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Ap2b1 APN 11 83,223,984 (GRCm39) missense probably damaging 0.99
IGL01583:Ap2b1 APN 11 83,215,437 (GRCm39) missense possibly damaging 0.61
IGL01753:Ap2b1 APN 11 83,212,799 (GRCm39) missense probably damaging 1.00
IGL01992:Ap2b1 APN 11 83,226,356 (GRCm39) missense probably damaging 1.00
IGL02192:Ap2b1 APN 11 83,237,592 (GRCm39) missense possibly damaging 0.48
IGL02315:Ap2b1 APN 11 83,227,625 (GRCm39) missense probably damaging 0.96
IGL03235:Ap2b1 APN 11 83,232,210 (GRCm39) missense probably benign 0.41
P0045:Ap2b1 UTSW 11 83,258,852 (GRCm39) missense probably damaging 1.00
R0121:Ap2b1 UTSW 11 83,212,793 (GRCm39) missense possibly damaging 0.66
R0334:Ap2b1 UTSW 11 83,258,700 (GRCm39) splice site probably benign
R1222:Ap2b1 UTSW 11 83,237,564 (GRCm39) missense probably benign 0.06
R1297:Ap2b1 UTSW 11 83,223,935 (GRCm39) missense probably damaging 1.00
R1653:Ap2b1 UTSW 11 83,237,657 (GRCm39) missense probably damaging 1.00
R1719:Ap2b1 UTSW 11 83,215,430 (GRCm39) missense probably damaging 1.00
R1885:Ap2b1 UTSW 11 83,281,561 (GRCm39) missense probably damaging 0.99
R1886:Ap2b1 UTSW 11 83,281,561 (GRCm39) missense probably damaging 0.99
R1965:Ap2b1 UTSW 11 83,237,721 (GRCm39) missense probably benign 0.00
R1966:Ap2b1 UTSW 11 83,237,721 (GRCm39) missense probably benign 0.00
R2046:Ap2b1 UTSW 11 83,227,212 (GRCm39) missense probably benign 0.14
R2086:Ap2b1 UTSW 11 83,241,944 (GRCm39) missense possibly damaging 0.88
R2132:Ap2b1 UTSW 11 83,215,587 (GRCm39) splice site probably benign
R3615:Ap2b1 UTSW 11 83,215,391 (GRCm39) missense possibly damaging 0.84
R3616:Ap2b1 UTSW 11 83,215,391 (GRCm39) missense possibly damaging 0.84
R3983:Ap2b1 UTSW 11 83,281,542 (GRCm39) missense probably damaging 1.00
R4124:Ap2b1 UTSW 11 83,256,471 (GRCm39) critical splice acceptor site probably null
R4125:Ap2b1 UTSW 11 83,256,471 (GRCm39) critical splice acceptor site probably null
R4198:Ap2b1 UTSW 11 83,233,429 (GRCm39) missense probably damaging 1.00
R4202:Ap2b1 UTSW 11 83,226,430 (GRCm39) critical splice donor site probably null
R4543:Ap2b1 UTSW 11 83,215,476 (GRCm39) missense probably damaging 1.00
R4583:Ap2b1 UTSW 11 83,288,605 (GRCm39) missense probably benign 0.00
R4589:Ap2b1 UTSW 11 83,223,837 (GRCm39) nonsense probably null
R4916:Ap2b1 UTSW 11 83,281,532 (GRCm39) missense probably damaging 1.00
R5005:Ap2b1 UTSW 11 83,230,218 (GRCm39) missense probably damaging 1.00
R5385:Ap2b1 UTSW 11 83,233,427 (GRCm39) missense probably damaging 1.00
R5510:Ap2b1 UTSW 11 83,227,563 (GRCm39) splice site probably null
R5738:Ap2b1 UTSW 11 83,227,256 (GRCm39) splice site probably null
R6023:Ap2b1 UTSW 11 83,226,224 (GRCm39) missense probably damaging 0.99
R6269:Ap2b1 UTSW 11 83,237,499 (GRCm39) missense probably damaging 1.00
R6383:Ap2b1 UTSW 11 83,237,651 (GRCm39) missense probably damaging 1.00
R6416:Ap2b1 UTSW 11 83,199,065 (GRCm39) start codon destroyed probably null 1.00
R6502:Ap2b1 UTSW 11 83,233,505 (GRCm39) missense probably damaging 0.97
R6810:Ap2b1 UTSW 11 83,226,317 (GRCm39) missense possibly damaging 0.89
R6969:Ap2b1 UTSW 11 83,280,552 (GRCm39) missense probably damaging 0.99
R7238:Ap2b1 UTSW 11 83,223,948 (GRCm39) missense possibly damaging 0.91
R7241:Ap2b1 UTSW 11 83,241,931 (GRCm39) missense probably benign 0.16
R7429:Ap2b1 UTSW 11 83,258,824 (GRCm39) missense probably benign 0.00
R7588:Ap2b1 UTSW 11 83,215,348 (GRCm39) missense probably benign 0.00
R7635:Ap2b1 UTSW 11 83,280,554 (GRCm39) missense probably benign 0.09
R7651:Ap2b1 UTSW 11 83,230,256 (GRCm39) critical splice donor site probably null
R7753:Ap2b1 UTSW 11 83,258,733 (GRCm39) nonsense probably null
R8943:Ap2b1 UTSW 11 83,237,579 (GRCm39) missense probably damaging 1.00
R9093:Ap2b1 UTSW 11 83,215,395 (GRCm39) missense probably damaging 1.00
R9621:Ap2b1 UTSW 11 83,293,424 (GRCm39) missense probably damaging 1.00
X0064:Ap2b1 UTSW 11 83,215,395 (GRCm39) missense probably damaging 1.00
Z1177:Ap2b1 UTSW 11 83,256,579 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTAGCAGTGGAGCTACCTTGG -3'
(R):5'- GGAAAGCCAAATCAAGTTCTCTAGTC -3'

Sequencing Primer
(F):5'- GTGTTTTATAACCATTCCCACGGCAG -3'
(R):5'- TCAAGTTCTCTAGTCTACCAAGAAG -3'
Posted On 2021-01-18