Incidental Mutation 'R8468:Gphn'
ID 656924
Institutional Source Beutler Lab
Gene Symbol Gphn
Ensembl Gene ENSMUSG00000047454
Gene Name gephyrin
Synonyms 5730552E08Rik, geph
MMRRC Submission
Accession Numbers

Genbank: NM_145965, NM_172952; MGI: 109602

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8468 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 78226379-78684772 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 78226827 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 17 (V17A)
Ref Sequence ENSEMBL: ENSMUSP00000054064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052472] [ENSMUST00000110388]
AlphaFold Q8BUV3
Predicted Effect probably benign
Transcript: ENSMUST00000052472
AA Change: V17A

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000054064
Gene: ENSMUSG00000047454
AA Change: V17A

DomainStartEndE-ValueType
MoCF_biosynth 18 165 4.52e-27 SMART
low complexity region 186 201 N/A INTRINSIC
Pfam:MoeA_N 356 522 5.6e-53 PFAM
MoCF_biosynth 535 678 8.1e-38 SMART
Pfam:MoeA_C 691 766 8.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110388
AA Change: V17A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000106018
Gene: ENSMUSG00000047454
AA Change: V17A

DomainStartEndE-ValueType
MoCF_biosynth 18 165 4.52e-27 SMART
low complexity region 186 201 N/A INTRINSIC
Pfam:MoeA_N 360 525 2.1e-35 PFAM
MoCF_biosynth 538 681 8.1e-38 SMART
Pfam:MoeA_C 694 769 8.1e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a neuronal assembly protein that anchors inhibitory neurotransmitter receptors to the postsynaptic cytoskeleton via high affinity binding to a receptor subunit domain and tubulin dimers. In nonneuronal tissues, the encoded protein is also required for molybdenum cofactor biosynthesis. Mutations in this gene may be associated with the neurological condition hyperplexia and also lead to molybdenum cofactor deficiency. Numerous alternatively spliced transcript variants encoding different isoforms have been described; however, the full-length nature of all transcript variants is not currently known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die within one day of birth, apparently due to an inability to suckle. Apnea also develops within 12 hours of birth. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted, knock-out(1) Gene trapped(10)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A G 16: 85,795,556 W655R possibly damaging Het
Adamts3 C T 5: 89,694,768 A748T probably benign Het
Ano1 A C 7: 144,655,620 F248C probably damaging Het
Ap2b1 T A 11: 83,351,065 L628Q probably damaging Het
BC035947 C A 1: 78,498,330 A522S probably damaging Het
Bdp1 A G 13: 100,060,568 V1103A probably benign Het
Cd248 T A 19: 5,069,882 I586N possibly damaging Het
Dnah9 C A 11: 65,831,730 M4428I probably benign Het
Epha5 T C 5: 84,142,416 probably null Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fastkd2 T A 1: 63,731,764 L93Q probably benign Het
Gm6665 T C 18: 31,820,400 D5G possibly damaging Het
Gpr85 A T 6: 13,836,296 L203H probably damaging Het
Grk6 A G 13: 55,451,385 Y166C probably damaging Het
Ints3 A G 3: 90,406,253 V356A probably damaging Het
Krt33b G A 11: 100,029,789 R13C probably damaging Het
Lgals3 A G 14: 47,381,647 I146V possibly damaging Het
Lrp1 G A 10: 127,558,650 R2565C probably damaging Het
Miip G T 4: 147,861,471 D325E probably damaging Het
Naaladl1 T A 19: 6,108,585 V249E probably damaging Het
Nfxl1 C T 5: 72,518,205 R811K possibly damaging Het
Olfr1145 T C 2: 87,810,738 I306T possibly damaging Het
Olfr676 A T 7: 105,035,746 I183F probably damaging Het
Olfr681 A G 7: 105,121,478 D7G probably benign Het
Olfr701 A G 7: 106,818,839 Y252C possibly damaging Het
Olfr822 C T 10: 130,074,434 T8I probably benign Het
Olfr994 T A 2: 85,430,178 Y217F probably damaging Het
Pkd2l2 A G 18: 34,427,411 D357G possibly damaging Het
Ppp1r36 A G 12: 76,436,205 Y189C probably damaging Het
Rev3l A G 10: 39,827,991 E2011G probably damaging Het
Sestd1 T A 2: 77,191,746 T534S probably benign Het
Sfmbt1 G A 14: 30,773,984 A75T probably benign Het
Smarcc2 G A 10: 128,484,393 R882H probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Speg C T 1: 75,431,309 A3216V probably damaging Het
Vmn1r12 A G 6: 57,159,385 T112A probably benign Het
Zfp937 T G 2: 150,238,714 D221E probably benign Het
Other mutations in Gphn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Gphn APN 12 78504632 missense probably damaging 1.00
IGL00701:Gphn APN 12 78626167 missense possibly damaging 0.93
IGL00844:Gphn APN 12 78664568 splice site probably benign
IGL01517:Gphn APN 12 78376374 missense probably damaging 1.00
IGL02499:Gphn APN 12 78492300 missense probably benign 0.17
IGL02827:Gphn APN 12 78609220 missense probably damaging 1.00
IGL03136:Gphn APN 12 78481333 missense possibly damaging 0.69
IGL03348:Gphn APN 12 78627119 missense probably damaging 0.99
IGL03382:Gphn APN 12 78481313 missense probably damaging 1.00
grizzlies UTSW 12 78654880 missense probably benign 0.28
3-1:Gphn UTSW 12 78613001 missense probably benign 0.06
R0054:Gphn UTSW 12 78637503 missense probably damaging 1.00
R0054:Gphn UTSW 12 78637503 missense probably damaging 1.00
R0212:Gphn UTSW 12 78637552 missense probably damaging 0.99
R0389:Gphn UTSW 12 78590659 missense probably damaging 1.00
R0535:Gphn UTSW 12 78492050 missense possibly damaging 0.90
R1464:Gphn UTSW 12 78612964 splice site probably benign
R1503:Gphn UTSW 12 78504629 missense possibly damaging 0.94
R1606:Gphn UTSW 12 78683883 missense probably damaging 1.00
R1896:Gphn UTSW 12 78412354 missense possibly damaging 0.74
R2248:Gphn UTSW 12 78454821 missense probably damaging 1.00
R3708:Gphn UTSW 12 78532693 missense probably benign
R3907:Gphn UTSW 12 78493942 splice site probably benign
R4537:Gphn UTSW 12 78494014 missense probably benign 0.03
R4667:Gphn UTSW 12 78454817 missense probably damaging 1.00
R4808:Gphn UTSW 12 78654880 missense probably benign 0.28
R4840:Gphn UTSW 12 78522955 critical splice donor site probably null
R4852:Gphn UTSW 12 78627210 missense probably damaging 1.00
R4854:Gphn UTSW 12 78627210 missense probably damaging 1.00
R4855:Gphn UTSW 12 78627210 missense probably damaging 1.00
R5083:Gphn UTSW 12 78623289 splice site probably null
R5224:Gphn UTSW 12 78590587 missense probably damaging 0.99
R5580:Gphn UTSW 12 78492044 missense probably damaging 1.00
R5626:Gphn UTSW 12 78683897 missense probably benign 0.11
R6270:Gphn UTSW 12 78522950 missense probably benign
R6563:Gphn UTSW 12 78680396 critical splice donor site probably null
R6943:Gphn UTSW 12 78492181 missense possibly damaging 0.88
R6958:Gphn UTSW 12 78680299 missense possibly damaging 0.86
R7170:Gphn UTSW 12 78683889 missense possibly damaging 0.67
R7295:Gphn UTSW 12 78492102 missense probably benign 0.02
R7514:Gphn UTSW 12 78626165 missense probably damaging 0.97
R7537:Gphn UTSW 12 78504680 missense possibly damaging 0.62
R7680:Gphn UTSW 12 78412374 missense probably benign 0.14
R8236:Gphn UTSW 12 78664537 missense probably damaging 1.00
R8377:Gphn UTSW 12 78664506 missense probably damaging 1.00
R8409:Gphn UTSW 12 78613010 missense probably damaging 1.00
R8742:Gphn UTSW 12 78612992 missense probably damaging 1.00
R8832:Gphn UTSW 12 78412400 synonymous silent
R8845:Gphn UTSW 12 78492179 missense probably benign 0.30
R8972:Gphn UTSW 12 78609239 critical splice donor site probably null
R9254:Gphn UTSW 12 78627262 critical splice donor site probably null
R9287:Gphn UTSW 12 78562872 missense possibly damaging 0.68
R9355:Gphn UTSW 12 78492194 missense probably damaging 0.97
R9536:Gphn UTSW 12 78562862 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TCAGTCTCTTGCCATCCAGG -3'
(R):5'- CAGAGACTTTGGCTGCTAGG -3'

Sequencing Primer
(F):5'- TTGGGTCTCACTCCGCAGAG -3'
(R):5'- ACTTTGGCTGCTAGGGCTCC -3'
Posted On 2021-01-18