Incidental Mutation 'R8468:Grk6'
ID656925
Institutional Source Beutler Lab
Gene Symbol Grk6
Ensembl Gene ENSMUSG00000074886
Gene NameG protein-coupled receptor kinase 6
SynonymsGprk6
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8468 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location55445072-55460927 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55451385 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 166 (Y166C)
Ref Sequence ENSEMBL: ENSMUSP00000153344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001115] [ENSMUST00000099482] [ENSMUST00000224118] [ENSMUST00000224653] [ENSMUST00000224995] [ENSMUST00000225925]
Predicted Effect probably damaging
Transcript: ENSMUST00000001115
AA Change: Y166C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001115
Gene: ENSMUSG00000074886
AA Change: Y166C

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
RGS 52 171 1.81e-34 SMART
S_TKc 186 448 8.4e-90 SMART
S_TK_X 449 528 2.8e-8 SMART
low complexity region 572 584 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099482
AA Change: Y166C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097081
Gene: ENSMUSG00000074886
AA Change: Y166C

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
RGS 52 171 1.81e-34 SMART
S_TKc 186 448 8.4e-90 SMART
S_TK_X 449 528 2.8e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000224118
AA Change: Y166C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224653
AA Change: Y134C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224995
AA Change: Y166C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225925
AA Change: Y166C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates the activated forms of G protein-coupled receptors thus initiating their deactivation. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Whereas, homozygous mutant mice are viable and show no gross anatomical or behavioral abnormalites under normal physiological conditions, they exhibit locomotor supersensitivity to psychostimulants including cocaine and amphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A G 16: 85,795,556 W655R possibly damaging Het
Adamts3 C T 5: 89,694,768 A748T probably benign Het
Ano1 A C 7: 144,655,620 F248C probably damaging Het
Ap2b1 T A 11: 83,351,065 L628Q probably damaging Het
BC035947 C A 1: 78,498,330 A522S probably damaging Het
Bdp1 A G 13: 100,060,568 V1103A probably benign Het
Cd248 T A 19: 5,069,882 I586N possibly damaging Het
Dnah9 C A 11: 65,831,730 M4428I probably benign Het
Epha5 T C 5: 84,142,416 probably null Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fastkd2 T A 1: 63,731,764 L93Q probably benign Het
Gm6665 T C 18: 31,820,400 D5G possibly damaging Het
Gphn T C 12: 78,226,827 V17A probably benign Het
Gpr85 A T 6: 13,836,296 L203H probably damaging Het
Ints3 A G 3: 90,406,253 V356A probably damaging Het
Krt33b G A 11: 100,029,789 R13C probably damaging Het
Lgals3 A G 14: 47,381,647 I146V possibly damaging Het
Lrp1 G A 10: 127,558,650 R2565C probably damaging Het
Miip G T 4: 147,861,471 D325E probably damaging Het
Naaladl1 T A 19: 6,108,585 V249E probably damaging Het
Nfxl1 C T 5: 72,518,205 R811K possibly damaging Het
Olfr1145 T C 2: 87,810,738 I306T possibly damaging Het
Olfr676 A T 7: 105,035,746 I183F probably damaging Het
Olfr681 A G 7: 105,121,478 D7G probably benign Het
Olfr701 A G 7: 106,818,839 Y252C possibly damaging Het
Olfr822 C T 10: 130,074,434 T8I probably benign Het
Olfr994 T A 2: 85,430,178 Y217F probably damaging Het
Pkd2l2 A G 18: 34,427,411 D357G possibly damaging Het
Ppp1r36 A G 12: 76,436,205 Y189C probably damaging Het
Rev3l A G 10: 39,827,991 E2011G probably damaging Het
Sestd1 T A 2: 77,191,746 T534S probably benign Het
Sfmbt1 G A 14: 30,773,984 A75T probably benign Het
Smarcc2 G A 10: 128,484,393 R882H probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Speg C T 1: 75,431,309 A3216V probably damaging Het
Vmn1r12 A G 6: 57,159,385 T112A probably benign Het
Zfp937 T G 2: 150,238,714 D221E probably benign Het
Other mutations in Grk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01733:Grk6 APN 13 55451391 missense possibly damaging 0.92
IGL02054:Grk6 APN 13 55454397 missense probably benign 0.03
IGL02156:Grk6 APN 13 55449361 missense possibly damaging 0.86
IGL02442:Grk6 APN 13 55458937 splice site probably benign
IGL02750:Grk6 APN 13 55451543 missense probably damaging 1.00
IGL03340:Grk6 APN 13 55453190 missense probably damaging 1.00
Damper UTSW 13 55458920 missense probably damaging 1.00
Piano UTSW 13 55454527 critical splice donor site probably null
R0080:Grk6 UTSW 13 55458910 missense probably benign 0.00
R1077:Grk6 UTSW 13 55454527 critical splice donor site probably null
R1530:Grk6 UTSW 13 55458799 missense probably damaging 0.99
R1531:Grk6 UTSW 13 55452154 missense probably damaging 1.00
R1733:Grk6 UTSW 13 55453166 splice site probably benign
R1851:Grk6 UTSW 13 55451778 nonsense probably null
R1874:Grk6 UTSW 13 55450273 missense probably damaging 1.00
R2142:Grk6 UTSW 13 55454364 missense probably damaging 1.00
R2875:Grk6 UTSW 13 55452304 missense probably damaging 1.00
R5187:Grk6 UTSW 13 55451706 missense probably damaging 1.00
R7010:Grk6 UTSW 13 55450300 missense possibly damaging 0.74
R7104:Grk6 UTSW 13 55454406 missense probably benign 0.36
R7111:Grk6 UTSW 13 55458920 missense probably damaging 1.00
R7769:Grk6 UTSW 13 55451007 missense probably benign 0.01
R7982:Grk6 UTSW 13 55451706 missense probably damaging 1.00
R8401:Grk6 UTSW 13 55452168 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCAGTGAGAAGCTTGCCGAAG -3'
(R):5'- TACTCTGCAAAGACCTGGGTG -3'

Sequencing Primer
(F):5'- AAGGAAAAGGATGTTGCTTTGTGTC -3'
(R):5'- AAAGACCTGGGTGGCCACTTAC -3'
Posted On2021-01-18