Incidental Mutation 'R8468:Bdp1'
ID 656926
Institutional Source Beutler Lab
Gene Symbol Bdp1
Ensembl Gene ENSMUSG00000049658
Gene Name B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
Synonyms TAF3B1, TFC5, Tfnr, B130055N23Rik, TFIIIB90, TFIIIB150, G630013P12Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001081061; MGI: 1347077

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8468 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 100017994-100104070 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 100060568 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1103 (V1103A)
Ref Sequence ENSEMBL: ENSMUSP00000038321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038104] [ENSMUST00000109379]
AlphaFold Q571C7
Predicted Effect probably benign
Transcript: ENSMUST00000038104
AA Change: V1103A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000038321
Gene: ENSMUSG00000049658
AA Change: V1103A

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
SANT 301 349 1.52e-4 SMART
coiled coil region 375 399 N/A INTRINSIC
coiled coil region 457 487 N/A INTRINSIC
internal_repeat_1 593 895 3.56e-18 PROSPERO
coiled coil region 1013 1038 N/A INTRINSIC
internal_repeat_1 1253 1612 3.56e-18 PROSPERO
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1763 1774 N/A INTRINSIC
low complexity region 1912 1921 N/A INTRINSIC
low complexity region 2185 2199 N/A INTRINSIC
low complexity region 2335 2346 N/A INTRINSIC
low complexity region 2398 2412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099262
Predicted Effect probably benign
Transcript: ENSMUST00000109379
AA Change: V1103A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000105005
Gene: ENSMUSG00000049658
AA Change: V1103A

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
SANT 301 349 1.52e-4 SMART
coiled coil region 457 487 N/A INTRINSIC
internal_repeat_1 593 895 4.79e-19 PROSPERO
coiled coil region 1013 1038 N/A INTRINSIC
internal_repeat_1 1253 1612 4.79e-19 PROSPERO
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1763 1774 N/A INTRINSIC
low complexity region 1912 1921 N/A INTRINSIC
low complexity region 2185 2199 N/A INTRINSIC
low complexity region 2335 2346 N/A INTRINSIC
low complexity region 2398 2412 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a subunit of the TFIIIB transcription initiation complex, which recruits RNA polymerase III to target promoters in order to initiate transcription. The encoded protein localizes to concentrated aggregates in the nucleus, and is required for transcription from all three types of polymerase III promoters. It is phosphorylated by casein kinase II during mitosis, resulting in its release from chromatin and suppression of polymerase III transcription. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A G 16: 85,795,556 W655R possibly damaging Het
Adamts3 C T 5: 89,694,768 A748T probably benign Het
Ano1 A C 7: 144,655,620 F248C probably damaging Het
Ap2b1 T A 11: 83,351,065 L628Q probably damaging Het
BC035947 C A 1: 78,498,330 A522S probably damaging Het
Cd248 T A 19: 5,069,882 I586N possibly damaging Het
Dnah9 C A 11: 65,831,730 M4428I probably benign Het
Epha5 T C 5: 84,142,416 probably null Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fastkd2 T A 1: 63,731,764 L93Q probably benign Het
Gm6665 T C 18: 31,820,400 D5G possibly damaging Het
Gphn T C 12: 78,226,827 V17A probably benign Het
Gpr85 A T 6: 13,836,296 L203H probably damaging Het
Grk6 A G 13: 55,451,385 Y166C probably damaging Het
Ints3 A G 3: 90,406,253 V356A probably damaging Het
Krt33b G A 11: 100,029,789 R13C probably damaging Het
Lgals3 A G 14: 47,381,647 I146V possibly damaging Het
Lrp1 G A 10: 127,558,650 R2565C probably damaging Het
Miip G T 4: 147,861,471 D325E probably damaging Het
Naaladl1 T A 19: 6,108,585 V249E probably damaging Het
Nfxl1 C T 5: 72,518,205 R811K possibly damaging Het
Olfr1145 T C 2: 87,810,738 I306T possibly damaging Het
Olfr676 A T 7: 105,035,746 I183F probably damaging Het
Olfr681 A G 7: 105,121,478 D7G probably benign Het
Olfr701 A G 7: 106,818,839 Y252C possibly damaging Het
Olfr822 C T 10: 130,074,434 T8I probably benign Het
Olfr994 T A 2: 85,430,178 Y217F probably damaging Het
Pkd2l2 A G 18: 34,427,411 D357G possibly damaging Het
Ppp1r36 A G 12: 76,436,205 Y189C probably damaging Het
Rev3l A G 10: 39,827,991 E2011G probably damaging Het
Sestd1 T A 2: 77,191,746 T534S probably benign Het
Sfmbt1 G A 14: 30,773,984 A75T probably benign Het
Smarcc2 G A 10: 128,484,393 R882H probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Speg C T 1: 75,431,309 A3216V probably damaging Het
Vmn1r12 A G 6: 57,159,385 T112A probably benign Het
Zfp937 T G 2: 150,238,714 D221E probably benign Het
Other mutations in Bdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Bdp1 APN 13 100098510 missense probably damaging 1.00
IGL00096:Bdp1 APN 13 100060865 missense possibly damaging 0.61
IGL00160:Bdp1 APN 13 100061198 missense probably benign 0.00
IGL00924:Bdp1 APN 13 100097579 missense possibly damaging 0.89
IGL01337:Bdp1 APN 13 100056192 missense probably benign 0.00
IGL01344:Bdp1 APN 13 100078080 missense probably benign 0.06
IGL01347:Bdp1 APN 13 100070203 missense possibly damaging 0.79
IGL01620:Bdp1 APN 13 100084205 splice site probably benign
IGL01871:Bdp1 APN 13 100066053 missense probably benign 0.01
IGL02008:Bdp1 APN 13 100023827 missense possibly damaging 0.92
IGL02112:Bdp1 APN 13 100037800 missense probably benign 0.02
IGL02214:Bdp1 APN 13 100041535 missense probably benign 0.00
IGL02236:Bdp1 APN 13 100060891 missense probably benign
IGL02307:Bdp1 APN 13 100093438 missense probably damaging 1.00
IGL02364:Bdp1 APN 13 100055308 splice site probably benign
IGL02415:Bdp1 APN 13 100089408 missense probably damaging 0.96
IGL02601:Bdp1 APN 13 100098514 missense possibly damaging 0.72
IGL02605:Bdp1 APN 13 100078115 critical splice acceptor site probably null
IGL02664:Bdp1 APN 13 100051539 missense probably benign 0.29
IGL02738:Bdp1 APN 13 100051353 missense probably benign 0.26
IGL02754:Bdp1 APN 13 100060973 missense possibly damaging 0.94
IGL02967:Bdp1 APN 13 100042270 missense possibly damaging 0.92
IGL02974:Bdp1 APN 13 100055292 missense probably benign 0.00
IGL03156:Bdp1 APN 13 100061036 missense probably benign 0.44
IGL03166:Bdp1 APN 13 100035800 missense probably benign 0.28
IGL03232:Bdp1 APN 13 100051481 missense probably damaging 1.00
D3080:Bdp1 UTSW 13 100023621 missense probably benign 0.02
R0115:Bdp1 UTSW 13 100041454 missense probably benign 0.28
R0481:Bdp1 UTSW 13 100041454 missense probably benign 0.28
R0619:Bdp1 UTSW 13 100037858 missense probably benign 0.00
R0730:Bdp1 UTSW 13 100058951 splice site probably benign
R0744:Bdp1 UTSW 13 100035825 missense probably benign 0.01
R0833:Bdp1 UTSW 13 100035825 missense probably benign 0.01
R1307:Bdp1 UTSW 13 100049763 missense possibly damaging 0.89
R1325:Bdp1 UTSW 13 100099008 missense probably damaging 0.97
R1346:Bdp1 UTSW 13 100078755 nonsense probably null
R1644:Bdp1 UTSW 13 100060940 missense probably benign 0.03
R1670:Bdp1 UTSW 13 100027433 critical splice donor site probably null
R1836:Bdp1 UTSW 13 100035145 missense probably benign
R1869:Bdp1 UTSW 13 100042201 missense probably damaging 0.99
R1920:Bdp1 UTSW 13 100098589 missense probably benign 0.30
R1944:Bdp1 UTSW 13 100074381 splice site probably null
R2030:Bdp1 UTSW 13 100061189 missense probably benign 0.00
R2069:Bdp1 UTSW 13 100050988 missense probably benign 0.00
R2180:Bdp1 UTSW 13 100061405 small insertion probably benign
R2263:Bdp1 UTSW 13 100066037 missense probably damaging 0.96
R2277:Bdp1 UTSW 13 100061330 missense probably benign 0.05
R2277:Bdp1 UTSW 13 100061339 missense probably damaging 1.00
R2278:Bdp1 UTSW 13 100061330 missense probably benign 0.05
R2278:Bdp1 UTSW 13 100061339 missense probably damaging 1.00
R2336:Bdp1 UTSW 13 100053002 missense probably damaging 0.99
R2380:Bdp1 UTSW 13 100060370 missense probably benign 0.08
R3154:Bdp1 UTSW 13 100049814 missense probably damaging 1.00
R4212:Bdp1 UTSW 13 100059585 missense probably benign
R4322:Bdp1 UTSW 13 100092223 missense probably damaging 0.97
R4414:Bdp1 UTSW 13 100030861 missense probably damaging 0.99
R4415:Bdp1 UTSW 13 100030861 missense probably damaging 0.99
R4764:Bdp1 UTSW 13 100056267 missense probably damaging 0.99
R4766:Bdp1 UTSW 13 100049868 missense probably damaging 0.96
R4888:Bdp1 UTSW 13 100051119 missense probably benign 0.26
R4914:Bdp1 UTSW 13 100056336 missense probably benign 0.28
R4917:Bdp1 UTSW 13 100055205 missense probably damaging 0.99
R4918:Bdp1 UTSW 13 100055205 missense probably damaging 0.99
R5170:Bdp1 UTSW 13 100030794 nonsense probably null
R5266:Bdp1 UTSW 13 100067535 missense probably benign 0.33
R5312:Bdp1 UTSW 13 100097601 splice site probably null
R5420:Bdp1 UTSW 13 100066043 missense possibly damaging 0.88
R5486:Bdp1 UTSW 13 100098510 missense probably damaging 1.00
R5909:Bdp1 UTSW 13 100092286 missense probably benign 0.08
R5913:Bdp1 UTSW 13 100051104 missense probably benign 0.41
R6018:Bdp1 UTSW 13 100038224 missense probably benign 0.00
R6037:Bdp1 UTSW 13 100027449 missense possibly damaging 0.65
R6037:Bdp1 UTSW 13 100027449 missense possibly damaging 0.65
R6700:Bdp1 UTSW 13 100025528 missense probably benign 0.00
R6969:Bdp1 UTSW 13 100074531 missense probably damaging 0.97
R6972:Bdp1 UTSW 13 100037761 missense probably null 1.00
R6996:Bdp1 UTSW 13 100043813 missense probably damaging 1.00
R7043:Bdp1 UTSW 13 100078707 missense probably benign 0.03
R7060:Bdp1 UTSW 13 100059494 missense probably damaging 1.00
R7105:Bdp1 UTSW 13 100070181 missense probably damaging 1.00
R7155:Bdp1 UTSW 13 100061151 missense possibly damaging 0.93
R7175:Bdp1 UTSW 13 100049970 missense probably damaging 0.97
R7177:Bdp1 UTSW 13 100049970 missense probably damaging 0.97
R7327:Bdp1 UTSW 13 100041532 missense probably damaging 0.97
R7512:Bdp1 UTSW 13 100050949 missense probably benign 0.03
R7562:Bdp1 UTSW 13 100025541 missense probably benign 0.04
R7583:Bdp1 UTSW 13 100049812 missense probably damaging 1.00
R7788:Bdp1 UTSW 13 100055251 missense possibly damaging 0.64
R7842:Bdp1 UTSW 13 100099129 missense probably damaging 1.00
R7850:Bdp1 UTSW 13 100092324 missense probably damaging 1.00
R7904:Bdp1 UTSW 13 100041436 missense probably benign 0.37
R7975:Bdp1 UTSW 13 100020376 missense probably benign 0.01
R7999:Bdp1 UTSW 13 100058896 missense possibly damaging 0.93
R8126:Bdp1 UTSW 13 100056282 missense probably damaging 1.00
R8340:Bdp1 UTSW 13 100065968 missense possibly damaging 0.61
R8414:Bdp1 UTSW 13 100064477 missense probably benign 0.03
R8688:Bdp1 UTSW 13 100103799 missense probably damaging 1.00
R8871:Bdp1 UTSW 13 100049667 missense probably damaging 1.00
R8976:Bdp1 UTSW 13 100060899 nonsense probably null
R8987:Bdp1 UTSW 13 100067513 missense probably benign 0.01
R9157:Bdp1 UTSW 13 100049928 missense probably benign 0.40
R9437:Bdp1 UTSW 13 100025650 missense probably benign 0.31
R9612:Bdp1 UTSW 13 100077862 missense probably benign 0.18
R9679:Bdp1 UTSW 13 100043777 missense probably damaging 0.98
RF003:Bdp1 UTSW 13 100060449 missense probably benign 0.31
RF003:Bdp1 UTSW 13 100060450 missense probably benign 0.31
Z1177:Bdp1 UTSW 13 100061396 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCAGAATTACATCTGCCTC -3'
(R):5'- GATTGGAGGAGGAACTTCCC -3'

Sequencing Primer
(F):5'- GGTTCACGTTCTCTTGGAGCAAC -3'
(R):5'- CTTCCCAGAGAGGAAAGGC -3'
Posted On 2021-01-18