Mutagenetix > Incidental Mutation

Incidental Mutation 'R8468:Son'

656930

Institutional Source

Beutler Lab

Gene Symbol

Son

Ensembl Gene

ENSMUSG00000022961

Gene Name

Son DNA binding protein

Synonyms

2900011L12Rik

MMRRC Submission

067912-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.955) question?

Stock #

R8468 (G1)

Quality Score

101.465

Status

Not validated

Chromosome

Chromosomal Location

91444712-91476080 bp(+) (GRCm39)

Type of Mutation

unclassified

DNA Base Change (assembly)

CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC to CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC at 91453579 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114036] [ENSMUST00000114037] [ENSMUST00000117633] [ENSMUST00000119368] [ENSMUST00000122302] [ENSMUST00000140312]

AlphaFold

Q9QX47

Predicted Effect

probably benign
Transcript: ENSMUST00000114036

SMART Domains

Protein: ENSMUSP00000109670
Gene: ENSMUSG00000022961

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	1.65e-7	PROSPERO
internal_repeat_2	214	362	6.55e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	1.65e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	6.55e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114037

SMART Domains

Protein: ENSMUSP00000109671
Gene: ENSMUSG00000022961

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	1.71e-7	PROSPERO
internal_repeat_2	214	362	7.05e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	1.71e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	7.05e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC
low complexity region	2149	2155	N/A	INTRINSIC
G_patch	2321	2367	1.15e-17	SMART
Pfam:DND1_DSRM	2388	2442	5.7e-15	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000117633

SMART Domains

Protein: ENSMUSP00000112453
Gene: ENSMUSG00000022961

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	1.59e-7	PROSPERO
internal_repeat_2	214	362	6.63e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	1.59e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	6.63e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
Pfam:RSRP	1909	2216	1e-12	PFAM
G_patch	2321	2367	1.15e-17	SMART
DSRM	2390	2458	5.37e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000119368

SMART Domains

Protein: ENSMUSP00000113129
Gene: ENSMUSG00000022961

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	2.22e-7	PROSPERO
internal_repeat_2	214	362	8.67e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	2.22e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	8.67e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC
low complexity region	2149	2155	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000122302

SMART Domains

Protein: ENSMUSP00000113615
Gene: ENSMUSG00000022961

Domain	Start	End	E-Value	Type
low complexity region	90	101	N/A	INTRINSIC
low complexity region	104	115	N/A	INTRINSIC
low complexity region	159	165	N/A	INTRINSIC
G_patch	331	377	1.15e-17	SMART
Pfam:DND1_DSRM	398	452	7.9e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000140312

SMART Domains

Protein: ENSMUSP00000122320
Gene: ENSMUSG00000022961

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	2.93e-7	PROSPERO
internal_repeat_2	214	362	1.1e-5	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	2.93e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	1.1e-5	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC
low complexity region	2149	2155	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000147891

SMART Domains

Protein: ENSMUSP00000122544
Gene: ENSMUSG00000022961

Domain	Start	End	E-Value	Type
Pfam:RSRP	61	358	2.9e-13	PFAM
low complexity region	466	477	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (36/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains multiple simple repeats. The encoded protein binds RNA and promotes pre-mRNA splicing, particularly of transcripts with poor splice sites. The protein also recognizes a specific DNA sequence found in the human hepatitis B virus (HBV) and represses HBV core promoter activity. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts1	A	G	16: 85,592,444 (GRCm39)	W655R	possibly damaging	Het
Adamts3	C	T	5: 89,842,627 (GRCm39)	A748T	probably benign	Het
Ano1	A	C	7: 144,209,357 (GRCm39)	F248C	probably damaging	Het
Ap2b1	T	A	11: 83,241,891 (GRCm39)	L628Q	probably damaging	Het
BC035947	C	A	1: 78,474,967 (GRCm39)	A522S	probably damaging	Het
Bdp1	A	G	13: 100,197,076 (GRCm39)	V1103A	probably benign	Het
Cd248	T	A	19: 5,119,910 (GRCm39)	I586N	possibly damaging	Het
Dnah9	C	A	11: 65,722,556 (GRCm39)	M4428I	probably benign	Het
Epha5	T	C	5: 84,290,275 (GRCm39)		probably null	Het
Fan1	T	A	7: 64,022,234 (GRCm39)	N340Y	probably damaging	Het
Fastkd2	T	A	1: 63,770,923 (GRCm39)	L93Q	probably benign	Het
Gm6665	T	C	18: 31,953,453 (GRCm39)	D5G	possibly damaging	Het
Gphn	T	C	12: 78,273,601 (GRCm39)	V17A	probably benign	Het
Gpr85	A	T	6: 13,836,295 (GRCm39)	L203H	probably damaging	Het
Grk6	A	G	13: 55,599,198 (GRCm39)	Y166C	probably damaging	Het
Ints3	A	G	3: 90,313,560 (GRCm39)	V356A	probably damaging	Het
Krt33b	G	A	11: 99,920,615 (GRCm39)	R13C	probably damaging	Het
Lgals3	A	G	14: 47,619,104 (GRCm39)	I146V	possibly damaging	Het
Lrp1	G	A	10: 127,394,519 (GRCm39)	R2565C	probably damaging	Het
Miip	G	T	4: 147,945,928 (GRCm39)	D325E	probably damaging	Het
Naaladl1	T	A	19: 6,158,615 (GRCm39)	V249E	probably damaging	Het
Nfxl1	C	T	5: 72,675,548 (GRCm39)	R811K	possibly damaging	Het
Or12e10	T	C	2: 87,641,082 (GRCm39)	I306T	possibly damaging	Het
Or2ag2b	A	G	7: 106,418,046 (GRCm39)	Y252C	possibly damaging	Het
Or52e7	A	T	7: 104,684,953 (GRCm39)	I183F	probably damaging	Het
Or56a3b	A	G	7: 104,770,685 (GRCm39)	D7G	probably benign	Het
Or5ak24	T	A	2: 85,260,522 (GRCm39)	Y217F	probably damaging	Het
Or6c69c	C	T	10: 129,910,303 (GRCm39)	T8I	probably benign	Het
Pkd2l2	A	G	18: 34,560,464 (GRCm39)	D357G	possibly damaging	Het
Ppp1r36	A	G	12: 76,482,979 (GRCm39)	Y189C	probably damaging	Het
Rev3l	A	G	10: 39,703,987 (GRCm39)	E2011G	probably damaging	Het
Sestd1	T	A	2: 77,022,090 (GRCm39)	T534S	probably benign	Het
Sfmbt1	G	A	14: 30,495,941 (GRCm39)	A75T	probably benign	Het
Smarcc2	G	A	10: 128,320,262 (GRCm39)	R882H	probably benign	Het
Speg	C	T	1: 75,407,953 (GRCm39)	A3216V	probably damaging	Het
Vmn1r12	A	G	6: 57,136,370 (GRCm39)	T112A	probably benign	Het
Zfp937	T	G	2: 150,080,634 (GRCm39)	D221E	probably benign	Het

Other mutations in Son

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00531:Son	APN	16	91,461,210 (GRCm39)	missense	probably damaging	0.99
IGL01024:Son	APN	16	91,452,798 (GRCm39)	missense	probably damaging	1.00
IGL01066:Son	APN	16	91,457,024 (GRCm39)	intron	probably benign
IGL01083:Son	APN	16	91,454,279 (GRCm39)	missense	probably damaging	1.00
IGL01115:Son	APN	16	91,456,346 (GRCm39)	missense	probably benign	0.31
IGL01467:Son	APN	16	91,454,165 (GRCm39)	missense	possibly damaging	0.93
IGL01506:Son	APN	16	91,454,174 (GRCm39)	missense	possibly damaging	0.67
IGL01933:Son	APN	16	91,454,903 (GRCm39)	missense	probably benign	0.00
IGL02156:Son	APN	16	91,452,992 (GRCm39)	missense	possibly damaging	0.93
IGL02473:Son	APN	16	91,455,683 (GRCm39)	missense	probably damaging	0.99
IGL02498:Son	APN	16	91,453,713 (GRCm39)	missense	probably damaging	0.99
IGL02517:Son	APN	16	91,452,099 (GRCm39)	missense	possibly damaging	0.92
IGL02530:Son	APN	16	91,455,359 (GRCm39)	missense	possibly damaging	0.50
IGL02865:Son	APN	16	91,448,640 (GRCm39)	missense	probably damaging	1.00
IGL03180:Son	APN	16	91,453,896 (GRCm39)	missense	probably damaging	1.00
R0013:Son	UTSW	16	91,448,550 (GRCm39)	missense	probably damaging	1.00
R0036:Son	UTSW	16	91,457,054 (GRCm39)	intron	probably benign
R0037:Son	UTSW	16	91,461,616 (GRCm39)	missense	probably damaging	1.00
R0041:Son	UTSW	16	91,456,221 (GRCm39)	missense	probably damaging	1.00
R0048:Son	UTSW	16	91,455,865 (GRCm39)	missense	possibly damaging	0.94
R0048:Son	UTSW	16	91,455,865 (GRCm39)	missense	possibly damaging	0.94
R0056:Son	UTSW	16	91,475,043 (GRCm39)	missense	possibly damaging	0.86
R0227:Son	UTSW	16	91,453,761 (GRCm39)	missense	probably damaging	0.99
R0256:Son	UTSW	16	91,453,472 (GRCm39)	missense	possibly damaging	0.95
R0302:Son	UTSW	16	91,453,032 (GRCm39)	missense	probably damaging	1.00
R0815:Son	UTSW	16	91,452,372 (GRCm39)	missense	probably damaging	0.98
R1225:Son	UTSW	16	91,454,228 (GRCm39)	missense	probably damaging	1.00
R1255:Son	UTSW	16	91,461,583 (GRCm39)	missense	probably damaging	1.00
R1457:Son	UTSW	16	91,453,974 (GRCm39)	missense	probably damaging	1.00
R1459:Son	UTSW	16	91,452,230 (GRCm39)	missense	possibly damaging	0.93
R1535:Son	UTSW	16	91,456,622 (GRCm39)	missense	probably damaging	0.99
R1587:Son	UTSW	16	91,456,606 (GRCm39)	missense	probably damaging	1.00
R1605:Son	UTSW	16	91,454,552 (GRCm39)	missense	probably damaging	1.00
R1629:Son	UTSW	16	91,454,510 (GRCm39)	missense	probably damaging	1.00
R1711:Son	UTSW	16	91,457,114 (GRCm39)	intron	probably benign
R2138:Son	UTSW	16	91,456,260 (GRCm39)	missense	possibly damaging	0.95
R2245:Son	UTSW	16	91,444,848 (GRCm39)	splice site	probably null
R2351:Son	UTSW	16	91,454,547 (GRCm39)	missense	probably damaging	0.98
R2434:Son	UTSW	16	91,451,575 (GRCm39)	missense	probably damaging	1.00
R2870:Son	UTSW	16	91,461,205 (GRCm39)	splice site	probably null
R2871:Son	UTSW	16	91,461,205 (GRCm39)	splice site	probably null
R2872:Son	UTSW	16	91,461,205 (GRCm39)	splice site	probably null
R2889:Son	UTSW	16	91,456,787 (GRCm39)	unclassified	probably benign
R3712:Son	UTSW	16	91,453,614 (GRCm39)	missense	probably damaging	0.99
R3913:Son	UTSW	16	91,456,999 (GRCm39)	intron	probably benign
R4172:Son	UTSW	16	91,456,250 (GRCm39)	missense	probably damaging	1.00
R4301:Son	UTSW	16	91,455,299 (GRCm39)	missense	possibly damaging	0.53
R4302:Son	UTSW	16	91,455,299 (GRCm39)	missense	possibly damaging	0.53
R4770:Son	UTSW	16	91,455,756 (GRCm39)	missense	probably damaging	0.96
R4881:Son	UTSW	16	91,472,397 (GRCm39)	missense	probably benign	0.31
R5020:Son	UTSW	16	91,453,263 (GRCm39)	missense	probably damaging	1.00
R5032:Son	UTSW	16	91,454,552 (GRCm39)	missense	probably damaging	1.00
R5151:Son	UTSW	16	91,452,587 (GRCm39)	missense	probably damaging	1.00
R5153:Son	UTSW	16	91,451,910 (GRCm39)	missense	possibly damaging	0.86
R5215:Son	UTSW	16	91,453,563 (GRCm39)	missense	probably damaging	0.99
R5243:Son	UTSW	16	91,451,621 (GRCm39)	missense	probably damaging	1.00
R5354:Son	UTSW	16	91,452,627 (GRCm39)	missense	probably damaging	0.99
R5529:Son	UTSW	16	91,452,354 (GRCm39)	missense	probably damaging	1.00
R5696:Son	UTSW	16	91,468,301 (GRCm39)	missense	possibly damaging	0.67
R5763:Son	UTSW	16	91,454,378 (GRCm39)	missense	probably damaging	1.00
R5766:Son	UTSW	16	91,461,875 (GRCm39)	intron	probably benign
R5788:Son	UTSW	16	91,456,940 (GRCm39)	intron	probably benign
R5992:Son	UTSW	16	91,455,792 (GRCm39)	missense	probably benign	0.04
R6314:Son	UTSW	16	91,457,298 (GRCm39)	intron	probably benign
R6371:Son	UTSW	16	91,471,629 (GRCm39)
R6429:Son	UTSW	16	91,455,054 (GRCm39)	missense	probably benign	0.33
R6451:Son	UTSW	16	91,454,490 (GRCm39)	missense	probably damaging	0.99
R6489:Son	UTSW	16	91,452,044 (GRCm39)	missense	possibly damaging	0.70
R6513:Son	UTSW	16	91,456,835 (GRCm39)	intron	probably benign
R6753:Son	UTSW	16	91,454,076 (GRCm39)	missense	probably damaging	0.99
R6916:Son	UTSW	16	91,451,673 (GRCm39)	missense	probably damaging	0.97
R7070:Son	UTSW	16	91,453,729 (GRCm39)	unclassified	probably benign
R7079:Son	UTSW	16	91,453,729 (GRCm39)	unclassified	probably benign
R7110:Son	UTSW	16	91,453,406 (GRCm39)	missense	probably benign	0.01
R7120:Son	UTSW	16	91,467,414 (GRCm39)	missense	unknown
R7120:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R7167:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R7205:Son	UTSW	16	91,457,183 (GRCm39)	small deletion	probably benign
R7208:Son	UTSW	16	91,458,990 (GRCm39)	missense	unknown
R7219:Son	UTSW	16	91,461,889 (GRCm39)	missense	unknown
R7249:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R7328:Son	UTSW	16	91,455,278 (GRCm39)	missense	probably benign	0.33
R7330:Son	UTSW	16	91,453,486 (GRCm39)	unclassified	probably benign
R7374:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R7405:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R7420:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R7424:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R7464:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R7514:Son	UTSW	16	91,451,748 (GRCm39)	missense	probably damaging	0.99
R7555:Son	UTSW	16	91,455,810 (GRCm39)	missense	probably damaging	0.99
R7645:Son	UTSW	16	91,457,183 (GRCm39)	small deletion	probably benign
R7716:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R7718:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R7778:Son	UTSW	16	91,453,416 (GRCm39)	missense	probably damaging	0.99
R7824:Son	UTSW	16	91,453,416 (GRCm39)	missense	probably damaging	0.99
R7856:Son	UTSW	16	91,456,146 (GRCm39)	missense	probably damaging	0.99
R7870:Son	UTSW	16	91,453,486 (GRCm39)	unclassified	probably benign
R7928:Son	UTSW	16	91,453,729 (GRCm39)	unclassified	probably benign
R7972:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R7978:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R8000:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R8192:Son	UTSW	16	91,452,437 (GRCm39)	missense	possibly damaging	0.91
R8221:Son	UTSW	16	91,453,734 (GRCm39)	missense	probably damaging	1.00
R8227:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R8233:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R8255:Son	UTSW	16	91,461,824 (GRCm39)	missense	unknown
R8292:Son	UTSW	16	91,453,545 (GRCm39)	missense	possibly damaging	0.93
R8407:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R8495:Son	UTSW	16	91,457,183 (GRCm39)	small deletion	probably benign
R8772:Son	UTSW	16	91,454,826 (GRCm39)	missense	possibly damaging	0.65
R8796:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R8862:Son	UTSW	16	91,453,734 (GRCm39)	missense	probably damaging	1.00
R8962:Son	UTSW	16	91,455,057 (GRCm39)	missense	possibly damaging	0.91
R8972:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R8991:Son	UTSW	16	91,453,608 (GRCm39)	missense	possibly damaging	0.95
R8991:Son	UTSW	16	91,453,366 (GRCm39)	missense	probably benign	0.04
R9086:Son	UTSW	16	91,467,418 (GRCm39)	missense	unknown
R9138:Son	UTSW	16	91,452,006 (GRCm39)	missense	possibly damaging	0.80
R9232:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R9241:Son	UTSW	16	91,454,122 (GRCm39)	missense	probably damaging	0.96
R9258:Son	UTSW	16	91,474,570 (GRCm39)	missense	unknown
R9328:Son	UTSW	16	91,452,645 (GRCm39)	missense	possibly damaging	0.67
R9420:Son	UTSW	16	91,454,508 (GRCm39)	missense	probably damaging	0.98
R9468:Son	UTSW	16	91,454,439 (GRCm39)	missense	possibly damaging	0.53
R9500:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R9516:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R9595:Son	UTSW	16	91,454,241 (GRCm39)	missense	possibly damaging	0.73
R9679:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R9719:Son	UTSW	16	91,456,440 (GRCm39)	missense	probably damaging	0.96
R9749:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R9772:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R9782:Son	UTSW	16	91,444,838 (GRCm39)	missense	probably damaging	0.99
R9788:Son	UTSW	16	91,453,699 (GRCm39)	unclassified	probably benign
RF007:Son	UTSW	16	91,456,257 (GRCm39)	missense	possibly damaging	0.53
RF041:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
Z1176:Son	UTSW	16	91,452,689 (GRCm39)	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- AGCTTCTAACACCATGGAGACC -3'
(R):5'- GCTGGTTGCTAACATCTGGG -3'

Sequencing Primer
(F):5'- TGGAGACCCATATGTTAGCATCC -3'
(R):5'- GCTAACATCTGGGAGTCCATACTG -3'

Posted On

2021-01-18