Incidental Mutation 'R8468:Cd248'
ID 656933
Institutional Source Beutler Lab
Gene Symbol Cd248
Ensembl Gene ENSMUSG00000056481
Gene Name CD248 antigen, endosialin
Synonyms Tem1, 2610111G01Rik, Cd164l1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock # R8468 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 5068078-5070637 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 5069882 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 586 (I586N)
Ref Sequence ENSEMBL: ENSMUSP00000070847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070630] [ENSMUST00000140389] [ENSMUST00000151413]
AlphaFold Q91V98
Predicted Effect possibly damaging
Transcript: ENSMUST00000070630
AA Change: I586N

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000070847
Gene: ENSMUSG00000056481
AA Change: I586N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
CLECT 22 157 1.14e-14 SMART
Blast:CCP 164 225 5e-31 BLAST
EGF 234 272 5.32e-1 SMART
EGF 274 311 2.08e-3 SMART
EGF_CA 312 351 2.92e-7 SMART
low complexity region 363 387 N/A INTRINSIC
low complexity region 478 491 N/A INTRINSIC
low complexity region 620 634 N/A INTRINSIC
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140389
Predicted Effect probably benign
Transcript: ENSMUST00000151413
SMART Domains Protein: ENSMUSP00000121084
Gene: ENSMUSG00000061451

DomainStartEndE-ValueType
low complexity region 37 48 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (36/36)
MGI Phenotype PHENOTYPE: Homozygous null mice display decreased growth of implanted abdominal and intestinal tumors, but have normal wound healing and no gross morphological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A G 16: 85,795,556 W655R possibly damaging Het
Adamts3 C T 5: 89,694,768 A748T probably benign Het
Ano1 A C 7: 144,655,620 F248C probably damaging Het
Ap2b1 T A 11: 83,351,065 L628Q probably damaging Het
BC035947 C A 1: 78,498,330 A522S probably damaging Het
Bdp1 A G 13: 100,060,568 V1103A probably benign Het
Dnah9 C A 11: 65,831,730 M4428I probably benign Het
Epha5 T C 5: 84,142,416 probably null Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fastkd2 T A 1: 63,731,764 L93Q probably benign Het
Gm6665 T C 18: 31,820,400 D5G possibly damaging Het
Gphn T C 12: 78,226,827 V17A probably benign Het
Gpr85 A T 6: 13,836,296 L203H probably damaging Het
Grk6 A G 13: 55,451,385 Y166C probably damaging Het
Ints3 A G 3: 90,406,253 V356A probably damaging Het
Krt33b G A 11: 100,029,789 R13C probably damaging Het
Lgals3 A G 14: 47,381,647 I146V possibly damaging Het
Lrp1 G A 10: 127,558,650 R2565C probably damaging Het
Miip G T 4: 147,861,471 D325E probably damaging Het
Naaladl1 T A 19: 6,108,585 V249E probably damaging Het
Nfxl1 C T 5: 72,518,205 R811K possibly damaging Het
Olfr1145 T C 2: 87,810,738 I306T possibly damaging Het
Olfr676 A T 7: 105,035,746 I183F probably damaging Het
Olfr681 A G 7: 105,121,478 D7G probably benign Het
Olfr701 A G 7: 106,818,839 Y252C possibly damaging Het
Olfr822 C T 10: 130,074,434 T8I probably benign Het
Olfr994 T A 2: 85,430,178 Y217F probably damaging Het
Pkd2l2 A G 18: 34,427,411 D357G possibly damaging Het
Ppp1r36 A G 12: 76,436,205 Y189C probably damaging Het
Rev3l A G 10: 39,827,991 E2011G probably damaging Het
Sestd1 T A 2: 77,191,746 T534S probably benign Het
Sfmbt1 G A 14: 30,773,984 A75T probably benign Het
Smarcc2 G A 10: 128,484,393 R882H probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Speg C T 1: 75,431,309 A3216V probably damaging Het
Vmn1r12 A G 6: 57,159,385 T112A probably benign Het
Zfp937 T G 2: 150,238,714 D221E probably benign Het
Other mutations in Cd248
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02413:Cd248 APN 19 5070173 missense probably damaging 0.98
solidity UTSW 19 5069355 nonsense probably null
R0130:Cd248 UTSW 19 5069962 missense probably benign
R0145:Cd248 UTSW 19 5069023 missense possibly damaging 0.85
R1589:Cd248 UTSW 19 5069932 missense probably benign 0.01
R2091:Cd248 UTSW 19 5070046 missense possibly damaging 0.84
R2253:Cd248 UTSW 19 5068126 start codon destroyed probably null
R2381:Cd248 UTSW 19 5069193 missense possibly damaging 0.68
R2386:Cd248 UTSW 19 5069193 missense possibly damaging 0.68
R3892:Cd248 UTSW 19 5069506 missense probably damaging 0.99
R4259:Cd248 UTSW 19 5068838 missense probably damaging 0.99
R4695:Cd248 UTSW 19 5068445 missense probably damaging 0.98
R4897:Cd248 UTSW 19 5069167 missense probably benign 0.33
R4985:Cd248 UTSW 19 5069792 missense probably damaging 0.96
R5491:Cd248 UTSW 19 5070209 missense probably damaging 1.00
R5688:Cd248 UTSW 19 5069935 missense probably benign 0.01
R6301:Cd248 UTSW 19 5069981 missense probably benign 0.03
R7260:Cd248 UTSW 19 5069355 nonsense probably null
R8824:Cd248 UTSW 19 5069617 missense probably benign 0.01
R9129:Cd248 UTSW 19 5070112 missense probably benign 0.34
Z1177:Cd248 UTSW 19 5069165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAAGCCTGGGATAACCTC -3'
(R):5'- CTCTGGAATAGGAATGTGTAGGGC -3'

Sequencing Primer
(F):5'- TGGGATAACCTCGGCCACTC -3'
(R):5'- AATGTGTAGGGCTGATAGATGAGGTC -3'
Posted On 2021-01-18