Incidental Mutation 'R8469:Ssh2'
ID656952
Institutional Source Beutler Lab
Gene Symbol Ssh2
Ensembl Gene ENSMUSG00000037926
Gene Nameslingshot protein phosphatase 2
SynonymsSSH-2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R8469 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location77216287-77460220 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77449608 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 529 (T529A)
Ref Sequence ENSEMBL: ENSMUSP00000137933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037912] [ENSMUST00000181283]
Predicted Effect probably benign
Transcript: ENSMUST00000037912
AA Change: T523A

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000042625
Gene: ENSMUSG00000037926
AA Change: T523A

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
Pfam:DEK_C 251 302 3.1e-13 PFAM
DSPc 307 445 2.2e-41 SMART
low complexity region 459 469 N/A INTRINSIC
low complexity region 871 882 N/A INTRINSIC
low complexity region 1002 1014 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181283
AA Change: T529A

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000137933
Gene: ENSMUSG00000037926
AA Change: T529A

DomainStartEndE-ValueType
Pfam:DEK_C 256 309 1.7e-18 PFAM
DSPc 313 451 2.2e-41 SMART
low complexity region 465 475 N/A INTRINSIC
low complexity region 877 888 N/A INTRINSIC
low complexity region 1008 1020 N/A INTRINSIC
low complexity region 1376 1391 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein tyrosine phosphatase that plays a key role in the regulation of actin filaments. The encoded protein dephosphorylates and activates cofilin, which promotes actin filament depolymerization. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik A G 16: 91,055,909 F113S probably damaging Het
Abcd4 A G 12: 84,612,416 Y189H probably damaging Het
Actn1 T C 12: 80,193,683 D210G possibly damaging Het
Adam28 C T 14: 68,606,580 V774I probably benign Het
Anapc1 A T 2: 128,658,344 probably null Het
Atg2b A T 12: 105,637,911 I1577N probably benign Het
Bod1l A G 5: 41,821,491 S827P possibly damaging Het
Carmil1 A T 13: 24,112,028 C377S probably damaging Het
Cplx4 T C 18: 65,957,012 E112G possibly damaging Het
Cyp4f39 C A 17: 32,492,366 R496S probably damaging Het
Dmgdh G A 13: 93,706,667 R337Q probably damaging Het
Dnah10 T C 5: 124,736,831 F345S probably damaging Het
Dst A G 1: 34,229,028 R2844G probably damaging Het
Fam186a T A 15: 99,947,305 I353L unknown Het
Fam78a A G 2: 32,069,333 V255A possibly damaging Het
Ino80 T A 2: 119,379,593 I1406L probably benign Het
Itga11 T C 9: 62,771,398 F949S probably benign Het
Jmjd7 G A 2: 120,030,162 A57T possibly damaging Het
Krt2 T C 15: 101,816,369 T269A probably benign Het
Lgi4 A T 7: 31,067,640 D364V probably damaging Het
Lrp12 T C 15: 39,872,395 T733A probably damaging Het
March7 T A 2: 60,234,326 N315K probably benign Het
Methig1 A G 15: 100,353,249 I14V probably benign Het
Mtmr3 A T 11: 4,531,223 M1K probably null Het
Nras A G 3: 103,058,901 probably benign Het
Nsd1 A G 13: 55,277,553 T1508A possibly damaging Het
Obscn T C 11: 59,128,237 T917A probably damaging Het
Pard6g T C 18: 80,047,132 V21A possibly damaging Het
Pcdha5 T A 18: 36,961,745 W436R probably benign Het
Pde4d T C 13: 108,860,188 V8A probably benign Het
Pou4f3 C T 18: 42,395,274 T94M probably benign Het
Prdm6 G T 18: 53,464,686 probably benign Het
Ralgapa1 T C 12: 55,739,413 R674G probably damaging Het
Rcc1 A G 4: 132,334,134 S368P probably damaging Het
Rcn2 T A 9: 56,045,201 V110E probably benign Het
Reep4 T A 14: 70,545,740 probably null Het
Rrbp1 T C 2: 143,989,741 I169V probably damaging Het
Slc2a6 T C 2: 27,024,335 S257G probably benign Het
Spag9 A G 11: 94,091,801 R612G probably damaging Het
Triobp A G 15: 78,967,019 S458G probably benign Het
Zfp729a G T 13: 67,621,362 H249Q probably damaging Het
Zfp940 A G 7: 29,845,147 I445T possibly damaging Het
Other mutations in Ssh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Ssh2 APN 11 77441926 missense probably damaging 1.00
IGL01141:Ssh2 APN 11 77449726 missense probably damaging 1.00
IGL01520:Ssh2 APN 11 77449906 missense probably damaging 1.00
IGL01803:Ssh2 APN 11 77425330 missense probably damaging 0.99
IGL01989:Ssh2 APN 11 77453685 missense possibly damaging 0.79
IGL02322:Ssh2 APN 11 77416413 critical splice acceptor site probably null
IGL02466:Ssh2 APN 11 77416407 splice site probably benign
IGL02683:Ssh2 APN 11 77398256 missense probably damaging 0.99
IGL02706:Ssh2 APN 11 77453406 missense possibly damaging 0.68
IGL02719:Ssh2 APN 11 77425587 missense probably damaging 1.00
IGL02721:Ssh2 APN 11 77454725 nonsense probably null
IGL02732:Ssh2 APN 11 77437776 splice site probably null
IGL02745:Ssh2 APN 11 77455407 missense probably damaging 1.00
IGL02993:Ssh2 APN 11 77453544 missense probably damaging 1.00
IGL03000:Ssh2 APN 11 77421206 splice site probably benign
david UTSW 11 77425593 missense probably damaging 1.00
faba UTSW 11 77441985 missense probably damaging 1.00
goliath UTSW 11 77453523 missense possibly damaging 0.48
Vicia UTSW 11 77454966 missense possibly damaging 0.68
IGL03055:Ssh2 UTSW 11 77408195 nonsense probably null
R0024:Ssh2 UTSW 11 77454966 missense possibly damaging 0.68
R0374:Ssh2 UTSW 11 77408143 missense probably damaging 1.00
R0539:Ssh2 UTSW 11 77454794 missense probably benign 0.11
R0834:Ssh2 UTSW 11 77437633 missense possibly damaging 0.87
R1714:Ssh2 UTSW 11 77454024 missense possibly damaging 0.94
R1743:Ssh2 UTSW 11 77437756 missense probably damaging 1.00
R1889:Ssh2 UTSW 11 77449745 missense probably damaging 1.00
R1895:Ssh2 UTSW 11 77449745 missense probably damaging 1.00
R3945:Ssh2 UTSW 11 77454668 missense possibly damaging 0.93
R3947:Ssh2 UTSW 11 77398256 missense probably damaging 0.99
R3948:Ssh2 UTSW 11 77398256 missense probably damaging 0.99
R4133:Ssh2 UTSW 11 77421269 missense probably damaging 1.00
R4256:Ssh2 UTSW 11 77408183 missense possibly damaging 0.48
R4499:Ssh2 UTSW 11 77393067 nonsense probably null
R4548:Ssh2 UTSW 11 77450184 missense probably benign 0.20
R4644:Ssh2 UTSW 11 77449576 missense possibly damaging 0.46
R4690:Ssh2 UTSW 11 77455205 missense possibly damaging 0.62
R4788:Ssh2 UTSW 11 77429798 missense probably damaging 1.00
R4919:Ssh2 UTSW 11 77425320 missense possibly damaging 0.91
R5014:Ssh2 UTSW 11 77455276 nonsense probably null
R5380:Ssh2 UTSW 11 77453945 missense probably benign 0.01
R5574:Ssh2 UTSW 11 77450115 missense probably benign
R5593:Ssh2 UTSW 11 77421366 missense probably damaging 0.99
R5739:Ssh2 UTSW 11 77449813 missense probably damaging 1.00
R6180:Ssh2 UTSW 11 77453465 missense probably benign 0.43
R6542:Ssh2 UTSW 11 77450150 missense possibly damaging 0.94
R6713:Ssh2 UTSW 11 77449433 missense possibly damaging 0.89
R7108:Ssh2 UTSW 11 77454794 missense probably benign
R7124:Ssh2 UTSW 11 77454338 missense probably benign 0.00
R7255:Ssh2 UTSW 11 77425593 missense probably damaging 1.00
R7332:Ssh2 UTSW 11 77453523 missense possibly damaging 0.48
R7362:Ssh2 UTSW 11 77449650 missense probably benign 0.01
R7395:Ssh2 UTSW 11 77393073 missense probably damaging 0.99
R7412:Ssh2 UTSW 11 77450108 missense probably damaging 0.98
R7493:Ssh2 UTSW 11 77437716 missense probably benign 0.16
R7686:Ssh2 UTSW 11 77425324 missense possibly damaging 0.89
R7870:Ssh2 UTSW 11 77453615 missense probably benign
R7895:Ssh2 UTSW 11 77454626 missense probably benign 0.41
R7963:Ssh2 UTSW 11 77421356 missense possibly damaging 0.93
R8030:Ssh2 UTSW 11 77454506 missense probably benign 0.01
R8065:Ssh2 UTSW 11 77441985 missense probably damaging 1.00
R8099:Ssh2 UTSW 11 77454929 nonsense probably null
R8294:Ssh2 UTSW 11 77454201 missense probably benign 0.08
R8464:Ssh2 UTSW 11 77454253 nonsense probably null
R8547:Ssh2 UTSW 11 77449707 missense probably benign 0.10
R8677:Ssh2 UTSW 11 77455193 missense possibly damaging 0.77
R8758:Ssh2 UTSW 11 77454017 missense probably benign
RF018:Ssh2 UTSW 11 77454054 missense probably damaging 0.99
X0017:Ssh2 UTSW 11 77441898 missense probably damaging 1.00
Z1088:Ssh2 UTSW 11 77449495 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCTTTCAGACCACCACG -3'
(R):5'- ATCTTCCACAGCTAAGTCTGG -3'

Sequencing Primer
(F):5'- GAACCCATCTGTAAACCTGGG -3'
(R):5'- TCCACAGCTAAGTCTGGGAACTTG -3'
Posted On2021-01-18