Incidental Mutation 'R8469:Spag9'
ID 656953
Institutional Source Beutler Lab
Gene Symbol Spag9
Ensembl Gene ENSMUSG00000020859
Gene Name sperm associated antigen 9
Synonyms syd1, JIP4, Mapk8ip4, 4733401I23Rik, JLP, 3110018C07Rik, 4831406C20Rik
MMRRC Submission
Accession Numbers

Genbank: NM_027569; MGI: 1918084

Is this an essential gene? Probably essential (E-score: 0.754) question?
Stock # R8469 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 93996091-94126085 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 94091801 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 612 (R612G)
Ref Sequence ENSEMBL: ENSMUSP00000042271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024979] [ENSMUST00000041956] [ENSMUST00000075695] [ENSMUST00000092777] [ENSMUST00000103168] [ENSMUST00000132079] [ENSMUST00000153076]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000024979
AA Change: R473G

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000024979
Gene: ENSMUSG00000020859
AA Change: R473G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 253 305 1e-25 PDB
low complexity region 306 339 N/A INTRINSIC
coiled coil region 572 606 N/A INTRINSIC
low complexity region 735 751 N/A INTRINSIC
SCOP:d1kb0a2 823 969 3e-5 SMART
Blast:WD40 924 964 8e-18 BLAST
low complexity region 1132 1150 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000041956
AA Change: R612G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000042271
Gene: ENSMUSG00000020859
AA Change: R612G

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 24 179 2e-61 PFAM
Pfam:JIP_LZII 390 460 5.3e-32 PFAM
coiled coil region 710 744 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
SCOP:d1kb0a2 961 1107 1e-5 SMART
Blast:WD40 1062 1102 1e-17 BLAST
low complexity region 1270 1288 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075695
AA Change: R473G

PolyPhen 2 Score 0.404 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000075115
Gene: ENSMUSG00000020859
AA Change: R473G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 253 305 1e-25 PDB
low complexity region 306 339 N/A INTRINSIC
coiled coil region 571 605 N/A INTRINSIC
low complexity region 734 750 N/A INTRINSIC
SCOP:d1kb0a2 822 968 3e-5 SMART
Blast:WD40 923 963 7e-18 BLAST
low complexity region 1131 1149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092777
AA Change: R474G

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000090452
Gene: ENSMUSG00000020859
AA Change: R474G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 254 306 1e-25 PDB
low complexity region 307 340 N/A INTRINSIC
coiled coil region 572 606 N/A INTRINSIC
low complexity region 735 751 N/A INTRINSIC
SCOP:d1kb0a2 823 969 3e-5 SMART
Blast:WD40 924 964 7e-18 BLAST
low complexity region 1132 1150 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103168
AA Change: R469G

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099457
Gene: ENSMUSG00000020859
AA Change: R469G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 249 301 1e-25 PDB
low complexity region 302 335 N/A INTRINSIC
coiled coil region 567 601 N/A INTRINSIC
low complexity region 730 746 N/A INTRINSIC
SCOP:d1kb0a2 818 964 3e-5 SMART
Blast:WD40 919 959 8e-18 BLAST
low complexity region 1127 1145 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132079
AA Change: R262G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118850
Gene: ENSMUSG00000020859
AA Change: R262G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
coiled coil region 360 394 N/A INTRINSIC
low complexity region 523 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153076
AA Change: R193G

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000117502
Gene: ENSMUSG00000020859
AA Change: R193G

DomainStartEndE-ValueType
PDB:2W83|D 1 25 4e-8 PDB
low complexity region 26 59 N/A INTRINSIC
coiled coil region 291 325 N/A INTRINSIC
low complexity region 454 470 N/A INTRINSIC
SCOP:d1kb0a2 542 688 3e-5 SMART
Blast:WD40 643 683 1e-17 BLAST
low complexity region 864 882 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000115864
Gene: ENSMUSG00000020859
AA Change: R461G

DomainStartEndE-ValueType
Pfam:JIP_LZII 240 310 1.1e-32 PFAM
coiled coil region 559 593 N/A INTRINSIC
low complexity region 723 739 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cancer testis antigen gene family. The encoded protein functions as a scaffold protein that structurally organizes mitogen-activated protein kinases and mediates c-Jun-terminal kinase signaling. This protein also binds to kinesin-1 and may be involved in microtubule-based membrane transport. This protein may play a role in tumor growth and development. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Male mice homozygous for a null mutation display reduced fertility with oligoasthenozoospermia. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Gene trapped(4)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik A G 16: 91,055,909 F113S probably damaging Het
Abcd4 A G 12: 84,612,416 Y189H probably damaging Het
Actn1 T C 12: 80,193,683 D210G possibly damaging Het
Adam28 C T 14: 68,606,580 V774I probably benign Het
Anapc1 A T 2: 128,658,344 probably null Het
Atg2b A T 12: 105,637,911 I1577N probably benign Het
Bod1l A G 5: 41,821,491 S827P possibly damaging Het
Carmil1 A T 13: 24,112,028 C377S probably damaging Het
Cplx4 T C 18: 65,957,012 E112G possibly damaging Het
Cyp4f39 C A 17: 32,492,366 R496S probably damaging Het
Dmgdh G A 13: 93,706,667 R337Q probably damaging Het
Dnah10 T C 5: 124,736,831 F345S probably damaging Het
Dst A G 1: 34,229,028 R2844G probably damaging Het
Fam186a T A 15: 99,947,305 I353L unknown Het
Fam78a A G 2: 32,069,333 V255A possibly damaging Het
Ino80 T A 2: 119,379,593 I1406L probably benign Het
Itga11 T C 9: 62,771,398 F949S probably benign Het
Jmjd7 G A 2: 120,030,162 A57T possibly damaging Het
Krt2 T C 15: 101,816,369 T269A probably benign Het
Lgi4 A T 7: 31,067,640 D364V probably damaging Het
Lrp12 T C 15: 39,872,395 T733A probably damaging Het
March7 T A 2: 60,234,326 N315K probably benign Het
Methig1 A G 15: 100,353,249 I14V probably benign Het
Mtmr3 A T 11: 4,531,223 M1K probably null Het
Nras A G 3: 103,058,901 probably benign Het
Nsd1 A G 13: 55,277,553 T1508A possibly damaging Het
Obscn T C 11: 59,128,237 T917A probably damaging Het
Pard6g T C 18: 80,047,132 V21A possibly damaging Het
Pcdha5 T A 18: 36,961,745 W436R probably benign Het
Pde4d T C 13: 108,860,188 V8A probably benign Het
Pou4f3 C T 18: 42,395,274 T94M probably benign Het
Prdm6 G T 18: 53,464,686 probably benign Het
Ralgapa1 T C 12: 55,739,413 R674G probably damaging Het
Rcc1 A G 4: 132,334,134 S368P probably damaging Het
Rcn2 T A 9: 56,045,201 V110E probably benign Het
Reep4 T A 14: 70,545,740 probably null Het
Rrbp1 T C 2: 143,989,741 I169V probably damaging Het
Slc2a6 T C 2: 27,024,335 S257G probably benign Het
Ssh2 A G 11: 77,449,608 T529A probably benign Het
Triobp A G 15: 78,967,019 S458G probably benign Het
Zfp729a G T 13: 67,621,362 H249Q probably damaging Het
Zfp940 A G 7: 29,845,147 I445T possibly damaging Het
Other mutations in Spag9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Spag9 APN 11 94097866 missense probably benign 0.02
IGL01776:Spag9 APN 11 94116727 splice site probably benign
IGL02095:Spag9 APN 11 94108582 missense probably damaging 1.00
IGL02307:Spag9 APN 11 94102160 critical splice donor site probably null
IGL02417:Spag9 APN 11 94116741 missense probably benign 0.27
IGL02480:Spag9 APN 11 94108587 nonsense probably null
IGL02864:Spag9 APN 11 94106661 missense probably damaging 1.00
IGL02976:Spag9 APN 11 94083953 missense probably benign 0.30
IGL02979:Spag9 APN 11 94097364 missense probably benign
IGL03349:Spag9 APN 11 94093509 missense possibly damaging 0.51
dazzle UTSW 11 94093624 nonsense probably null
R0128:Spag9 UTSW 11 94093539 missense probably damaging 1.00
R0418:Spag9 UTSW 11 94091753 splice site probably benign
R1463:Spag9 UTSW 11 94116837 missense probably damaging 1.00
R1593:Spag9 UTSW 11 94097233 missense probably damaging 1.00
R1605:Spag9 UTSW 11 94048539 missense probably damaging 0.99
R1649:Spag9 UTSW 11 94108452 splice site probably null
R1697:Spag9 UTSW 11 93996565 missense probably benign 0.00
R1952:Spag9 UTSW 11 94097358 missense possibly damaging 0.77
R2011:Spag9 UTSW 11 94092375 nonsense probably null
R2012:Spag9 UTSW 11 94092375 nonsense probably null
R2351:Spag9 UTSW 11 94092900 missense probably damaging 1.00
R2367:Spag9 UTSW 11 94116757 missense probably damaging 1.00
R3027:Spag9 UTSW 11 94086377 missense probably null 1.00
R3766:Spag9 UTSW 11 94060283 intron probably benign
R3777:Spag9 UTSW 11 94099026 critical splice acceptor site probably null
R3937:Spag9 UTSW 11 94044417 missense possibly damaging 0.94
R3937:Spag9 UTSW 11 94044479 missense possibly damaging 0.92
R4417:Spag9 UTSW 11 94060346 intron probably benign
R4445:Spag9 UTSW 11 94097253 missense possibly damaging 0.95
R4711:Spag9 UTSW 11 94114351 critical splice donor site probably null
R4799:Spag9 UTSW 11 94048516 missense possibly damaging 0.87
R4799:Spag9 UTSW 11 94048517 missense probably damaging 0.96
R4816:Spag9 UTSW 11 94048599 intron probably benign
R4843:Spag9 UTSW 11 94097818 missense probably damaging 1.00
R5020:Spag9 UTSW 11 94097786 missense probably benign 0.08
R5119:Spag9 UTSW 11 94122722 missense probably damaging 1.00
R5298:Spag9 UTSW 11 94100135 missense probably damaging 1.00
R5304:Spag9 UTSW 11 94069012 missense probably damaging 1.00
R5305:Spag9 UTSW 11 94069012 missense probably damaging 1.00
R5395:Spag9 UTSW 11 94091751 splice site probably null
R5636:Spag9 UTSW 11 94069012 missense probably damaging 1.00
R5638:Spag9 UTSW 11 94069012 missense probably damaging 1.00
R5654:Spag9 UTSW 11 94090712 missense probably damaging 1.00
R5779:Spag9 UTSW 11 94114253 missense probably benign 0.20
R5814:Spag9 UTSW 11 94082828 missense possibly damaging 0.94
R5912:Spag9 UTSW 11 94044425 missense probably damaging 0.98
R6038:Spag9 UTSW 11 94112092 missense probably damaging 1.00
R6038:Spag9 UTSW 11 94112092 missense probably damaging 1.00
R6269:Spag9 UTSW 11 94044507 missense probably benign 0.05
R6294:Spag9 UTSW 11 94093485 critical splice acceptor site probably null
R6389:Spag9 UTSW 11 94086311 missense probably damaging 1.00
R6420:Spag9 UTSW 11 94086302 missense probably damaging 1.00
R6460:Spag9 UTSW 11 94068975 missense probably damaging 1.00
R6482:Spag9 UTSW 11 94093502 missense possibly damaging 0.94
R6860:Spag9 UTSW 11 94081370 missense probably benign 0.25
R7086:Spag9 UTSW 11 94097864 missense probably benign
R7179:Spag9 UTSW 11 94089432 splice site probably null
R7225:Spag9 UTSW 11 94097358 missense probably damaging 0.98
R7351:Spag9 UTSW 11 94092976 missense probably benign 0.00
R7366:Spag9 UTSW 11 94108521 missense possibly damaging 0.56
R7378:Spag9 UTSW 11 94114351 critical splice donor site probably null
R7401:Spag9 UTSW 11 94097689 missense probably benign
R7506:Spag9 UTSW 11 94108464 missense probably damaging 1.00
R7507:Spag9 UTSW 11 94068080 missense probably benign 0.00
R7513:Spag9 UTSW 11 94112083 missense probably damaging 1.00
R7655:Spag9 UTSW 11 93996563 missense possibly damaging 0.56
R7656:Spag9 UTSW 11 93996563 missense possibly damaging 0.56
R7664:Spag9 UTSW 11 94102160 critical splice donor site probably null
R7665:Spag9 UTSW 11 94013654 missense probably damaging 0.98
R7862:Spag9 UTSW 11 94112066 missense possibly damaging 0.69
R8074:Spag9 UTSW 11 94112051 missense probably damaging 1.00
R8085:Spag9 UTSW 11 94099044 missense probably benign
R8547:Spag9 UTSW 11 94122821 missense possibly damaging 0.84
R8709:Spag9 UTSW 11 94068090 missense probably benign 0.02
R8732:Spag9 UTSW 11 94071688 critical splice donor site probably null
R8899:Spag9 UTSW 11 94092869 missense probably damaging 1.00
R8983:Spag9 UTSW 11 94067989 missense probably benign
R9043:Spag9 UTSW 11 94060259 missense
R9050:Spag9 UTSW 11 94044468 missense probably damaging 0.97
R9502:Spag9 UTSW 11 94068966 missense probably damaging 1.00
R9575:Spag9 UTSW 11 94071583 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCTGGTCTCACAAACATGG -3'
(R):5'- CCAAATCTAAGCAAGCTGAGATG -3'

Sequencing Primer
(F):5'- TGGTCTCACAAACATGGAAAAATCAG -3'
(R):5'- TGAGAAATTTAGGATATTGCTTCCAG -3'
Posted On 2021-01-18