Mutagenetix > Incidental Mutation

Incidental Mutation 'R8469:Krt2'

656969

Institutional Source

Beutler Lab

Gene Symbol

Krt2

Ensembl Gene

ENSMUSG00000064201

Gene Name

keratin 2

Synonyms

Krt2-17, Krt2-2, Krt2e

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.102) question?

Stock #

R8469 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101810689-101818169 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 101816369 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 269 (T269A)

Ref Sequence

ENSEMBL: ENSMUSP00000023712 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023712]

AlphaFold

Q3TTY5

Predicted Effect

probably benign
Transcript: ENSMUST00000023712
AA Change: T269A

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000023712
Gene: ENSMUSG00000064201
AA Change: T269A

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	23	195	3.6e-26	PFAM
Filament	198	511	4.22e-152	SMART
low complexity region	520	533	N/A	INTRINSIC
low complexity region	538	701	N/A	INTRINSIC

Meta Mutation Damage Score

0.1616

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (41/42)

MGI Phenotype

PHENOTYPE: ENU-induced mutant mice exhibit scaly skin and increased pigmentation in the tail, ears and feet. Mice homozygous for a knock-out allele show scaly skin, acanthosis, hyperkeratosis, increased water loss, ear skin inflammation, and aberrant aggregation of keratin 10 in suprabasal epidermal keratinocytes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438H23Rik	A	G	16: 91,055,909	F113S	probably damaging	Het
Abcd4	A	G	12: 84,612,416	Y189H	probably damaging	Het
Actn1	T	C	12: 80,193,683	D210G	possibly damaging	Het
Adam28	C	T	14: 68,606,580	V774I	probably benign	Het
Anapc1	A	T	2: 128,658,344		probably null	Het
Atg2b	A	T	12: 105,637,911	I1577N	probably benign	Het
Bod1l	A	G	5: 41,821,491	S827P	possibly damaging	Het
Carmil1	A	T	13: 24,112,028	C377S	probably damaging	Het
Cplx4	T	C	18: 65,957,012	E112G	possibly damaging	Het
Cyp4f39	C	A	17: 32,492,366	R496S	probably damaging	Het
Dmgdh	G	A	13: 93,706,667	R337Q	probably damaging	Het
Dnah10	T	C	5: 124,736,831	F345S	probably damaging	Het
Dst	A	G	1: 34,229,028	R2844G	probably damaging	Het
Fam186a	T	A	15: 99,947,305	I353L	unknown	Het
Fam78a	A	G	2: 32,069,333	V255A	possibly damaging	Het
Ino80	T	A	2: 119,379,593	I1406L	probably benign	Het
Itga11	T	C	9: 62,771,398	F949S	probably benign	Het
Jmjd7	G	A	2: 120,030,162	A57T	possibly damaging	Het
Lgi4	A	T	7: 31,067,640	D364V	probably damaging	Het
Lrp12	T	C	15: 39,872,395	T733A	probably damaging	Het
March7	T	A	2: 60,234,326	N315K	probably benign	Het
Methig1	A	G	15: 100,353,249	I14V	probably benign	Het
Mtmr3	A	T	11: 4,531,223	M1K	probably null	Het
Nras	A	G	3: 103,058,901		probably benign	Het
Nsd1	A	G	13: 55,277,553	T1508A	possibly damaging	Het
Obscn	T	C	11: 59,128,237	T917A	probably damaging	Het
Pard6g	T	C	18: 80,047,132	V21A	possibly damaging	Het
Pcdha5	T	A	18: 36,961,745	W436R	probably benign	Het
Pde4d	T	C	13: 108,860,188	V8A	probably benign	Het
Pou4f3	C	T	18: 42,395,274	T94M	probably benign	Het
Prdm6	G	T	18: 53,464,686		probably benign	Het
Ralgapa1	T	C	12: 55,739,413	R674G	probably damaging	Het
Rcc1	A	G	4: 132,334,134	S368P	probably damaging	Het
Rcn2	T	A	9: 56,045,201	V110E	probably benign	Het
Reep4	T	A	14: 70,545,740		probably null	Het
Rrbp1	T	C	2: 143,989,741	I169V	probably damaging	Het
Slc2a6	T	C	2: 27,024,335	S257G	probably benign	Het
Spag9	A	G	11: 94,091,801	R612G	probably damaging	Het
Ssh2	A	G	11: 77,449,608	T529A	probably benign	Het
Triobp	A	G	15: 78,967,019	S458G	probably benign	Het
Zfp729a	G	T	13: 67,621,362	H249Q	probably damaging	Het
Zfp940	A	G	7: 29,845,147	I445T	possibly damaging	Het

Other mutations in Krt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01316:Krt2	APN	15	101811211	missense	probably benign	0.23
IGL01568:Krt2	APN	15	101813211	missense	probably damaging	1.00
IGL01586:Krt2	APN	15	101811390	missense	unknown
IGL01667:Krt2	APN	15	101816330	missense	possibly damaging	0.85
IGL02017:Krt2	APN	15	101816504	missense	probably damaging	1.00
IGL02022:Krt2	APN	15	101816518	missense	probably damaging	1.00
IGL02538:Krt2	APN	15	101811154	missense	unknown
IGL02959:Krt2	APN	15	101811328	missense	unknown
IGL03295:Krt2	APN	15	101816429	missense	probably damaging	0.99
R0195:Krt2	UTSW	15	101813191	nonsense	probably null
R0472:Krt2	UTSW	15	101813253	missense	probably damaging	1.00
R0749:Krt2	UTSW	15	101817663	missense	unknown
R0785:Krt2	UTSW	15	101817921	missense	unknown
R0792:Krt2	UTSW	15	101816497	missense	probably damaging	1.00
R1232:Krt2	UTSW	15	101811784	missense	probably damaging	1.00
R1281:Krt2	UTSW	15	101813292	missense	probably damaging	1.00
R1770:Krt2	UTSW	15	101811154	missense	unknown
R1783:Krt2	UTSW	15	101813973	missense	probably damaging	1.00
R1795:Krt2	UTSW	15	101816426	missense	possibly damaging	0.85
R2283:Krt2	UTSW	15	101814387	missense	probably damaging	1.00
R3977:Krt2	UTSW	15	101811127	missense	unknown
R4575:Krt2	UTSW	15	101814486	missense	probably damaging	1.00
R4619:Krt2	UTSW	15	101817591	missense	probably damaging	1.00
R4620:Krt2	UTSW	15	101817591	missense	probably damaging	1.00
R4766:Krt2	UTSW	15	101813960	missense	probably damaging	1.00
R4819:Krt2	UTSW	15	101811544	missense	unknown
R4953:Krt2	UTSW	15	101813942	missense	probably damaging	1.00
R5108:Krt2	UTSW	15	101813286	missense	possibly damaging	0.88
R5973:Krt2	UTSW	15	101816312	missense	probably damaging	0.99
R6122:Krt2	UTSW	15	101815914	missense	probably damaging	1.00
R6180:Krt2	UTSW	15	101815044	missense	probably benign	0.05
R6661:Krt2	UTSW	15	101815963	missense	probably damaging	1.00
R6974:Krt2	UTSW	15	101817879	missense	unknown
R6993:Krt2	UTSW	15	101815960	missense	probably damaging	1.00
R7104:Krt2	UTSW	15	101815087	missense	probably benign	0.09
R7573:Krt2	UTSW	15	101814519	missense	probably benign	0.05
R7947:Krt2	UTSW	15	101816334	missense	probably damaging	1.00
R8805:Krt2	UTSW	15	101815944	missense	possibly damaging	0.93
R9051:Krt2	UTSW	15	101817882	missense	unknown
R9118:Krt2	UTSW	15	101814541	missense	probably damaging	0.99
R9230:Krt2	UTSW	15	101817513	missense	probably benign	0.39
R9257:Krt2	UTSW	15	101816491	missense	probably benign	0.05
R9424:Krt2	UTSW	15	101811357	missense	unknown
R9569:Krt2	UTSW	15	101816489	missense	probably damaging	1.00
R9576:Krt2	UTSW	15	101811357	missense	unknown
RF020:Krt2	UTSW	15	101817968	missense	unknown
Z1177:Krt2	UTSW	15	101811550	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CATGTTTGAGCTCCAAATCCC -3'
(R):5'- TTTCCTCTGGCCACTGTAGG -3'

Sequencing Primer
(F):5'- TTCTTTGCACTCAAAAAGGAGGCC -3'
(R):5'- CCACTGTAGGTGCGATTCCTG -3'

Posted On

2021-01-18