Incidental Mutation 'R8469:Prdm6'
ID656974
Institutional Source Beutler Lab
Gene Symbol Prdm6
Ensembl Gene ENSMUSG00000069378
Gene NamePR domain containing 6
SynonymsLOC225518, PRISM
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.787) question?
Stock #R8469 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location53464546-53575907 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 53464686 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091900] [ENSMUST00000154557]
Predicted Effect unknown
Transcript: ENSMUST00000091900
AA Change: S40I
SMART Domains Protein: ENSMUSP00000089513
Gene: ENSMUSG00000069378
AA Change: S40I

DomainStartEndE-ValueType
low complexity region 26 73 N/A INTRINSIC
low complexity region 77 113 N/A INTRINSIC
low complexity region 118 135 N/A INTRINSIC
low complexity region 141 166 N/A INTRINSIC
low complexity region 229 236 N/A INTRINSIC
SET 249 372 1.98e-3 SMART
ZnF_C2H2 474 494 1.24e2 SMART
ZnF_C2H2 502 524 1.58e-3 SMART
ZnF_C2H2 530 552 1.47e-3 SMART
ZnF_C2H2 558 578 1.2e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154557
SMART Domains Protein: ENSMUSP00000114644
Gene: ENSMUSG00000069378

DomainStartEndE-ValueType
low complexity region 68 75 N/A INTRINSIC
SET 88 211 1.98e-3 SMART
ZnF_C2H2 313 333 1.24e2 SMART
ZnF_C2H2 341 363 1.58e-3 SMART
ZnF_C2H2 369 391 1.47e-3 SMART
ZnF_C2H2 397 417 1.2e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit cardiovascular development defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik A G 16: 91,055,909 F113S probably damaging Het
Abcd4 A G 12: 84,612,416 Y189H probably damaging Het
Actn1 T C 12: 80,193,683 D210G possibly damaging Het
Adam28 C T 14: 68,606,580 V774I probably benign Het
Anapc1 A T 2: 128,658,344 probably null Het
Atg2b A T 12: 105,637,911 I1577N probably benign Het
Bod1l A G 5: 41,821,491 S827P possibly damaging Het
Carmil1 A T 13: 24,112,028 C377S probably damaging Het
Cplx4 T C 18: 65,957,012 E112G possibly damaging Het
Cyp4f39 C A 17: 32,492,366 R496S probably damaging Het
Dmgdh G A 13: 93,706,667 R337Q probably damaging Het
Dnah10 T C 5: 124,736,831 F345S probably damaging Het
Dst A G 1: 34,229,028 R2844G probably damaging Het
Fam186a T A 15: 99,947,305 I353L unknown Het
Fam78a A G 2: 32,069,333 V255A possibly damaging Het
Ino80 T A 2: 119,379,593 I1406L probably benign Het
Itga11 T C 9: 62,771,398 F949S probably benign Het
Jmjd7 G A 2: 120,030,162 A57T possibly damaging Het
Krt2 T C 15: 101,816,369 T269A probably benign Het
Lgi4 A T 7: 31,067,640 D364V probably damaging Het
Lrp12 T C 15: 39,872,395 T733A probably damaging Het
March7 T A 2: 60,234,326 N315K probably benign Het
Methig1 A G 15: 100,353,249 I14V probably benign Het
Mtmr3 A T 11: 4,531,223 M1K probably null Het
Nras A G 3: 103,058,901 probably benign Het
Nsd1 A G 13: 55,277,553 T1508A possibly damaging Het
Obscn T C 11: 59,128,237 T917A probably damaging Het
Pard6g T C 18: 80,047,132 V21A possibly damaging Het
Pcdha5 T A 18: 36,961,745 W436R probably benign Het
Pde4d T C 13: 108,860,188 V8A probably benign Het
Pou4f3 C T 18: 42,395,274 T94M probably benign Het
Ralgapa1 T C 12: 55,739,413 R674G probably damaging Het
Rcc1 A G 4: 132,334,134 S368P probably damaging Het
Rcn2 T A 9: 56,045,201 V110E probably benign Het
Reep4 T A 14: 70,545,740 probably null Het
Rrbp1 T C 2: 143,989,741 I169V probably damaging Het
Slc2a6 T C 2: 27,024,335 S257G probably benign Het
Spag9 A G 11: 94,091,801 R612G probably damaging Het
Ssh2 A G 11: 77,449,608 T529A probably benign Het
Triobp A G 15: 78,967,019 S458G probably benign Het
Zfp729a G T 13: 67,621,362 H249Q probably damaging Het
Zfp940 A G 7: 29,845,147 I445T possibly damaging Het
Other mutations in Prdm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Prdm6 APN 18 53540285 missense probably benign 0.08
IGL00743:Prdm6 APN 18 53540228 missense possibly damaging 0.84
IGL02183:Prdm6 APN 18 53464677 unclassified probably benign
R1720:Prdm6 UTSW 18 53540200 missense probably benign 0.29
R1879:Prdm6 UTSW 18 53568217 missense probably damaging 1.00
R1950:Prdm6 UTSW 18 53536724 missense possibly damaging 0.90
R1962:Prdm6 UTSW 18 53568161 missense probably damaging 1.00
R2022:Prdm6 UTSW 18 53464959 unclassified probably benign
R3973:Prdm6 UTSW 18 53540206 missense possibly damaging 0.94
R3974:Prdm6 UTSW 18 53540206 missense possibly damaging 0.94
R3975:Prdm6 UTSW 18 53540206 missense possibly damaging 0.94
R3976:Prdm6 UTSW 18 53540206 missense possibly damaging 0.94
R4012:Prdm6 UTSW 18 53540318 missense possibly damaging 0.70
R5144:Prdm6 UTSW 18 53465038 unclassified probably benign
R5640:Prdm6 UTSW 18 53536741 critical splice donor site probably null
R6113:Prdm6 UTSW 18 53473601 missense probably damaging 1.00
R6701:Prdm6 UTSW 18 53536679 missense possibly damaging 0.93
R6747:Prdm6 UTSW 18 53465046 unclassified probably benign
R6784:Prdm6 UTSW 18 53536626 missense probably benign 0.04
R7363:Prdm6 UTSW 18 53465127 missense possibly damaging 0.75
R8365:Prdm6 UTSW 18 53552065 missense probably benign 0.22
R8827:Prdm6 UTSW 18 53568195 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTAAACTTTGCGCCCAGGAG -3'
(R):5'- TAATAGTCCAGCTCCTCCGC -3'

Sequencing Primer
(F):5'- TGGTGCCGGATCCGAGAAG -3'
(R):5'- AGCGAACACCGGCATCTG -3'
Posted On2021-01-18