Incidental Mutation 'R8470:Olfr855'
ID 656993
Institutional Source Beutler Lab
Gene Symbol Olfr855
Ensembl Gene ENSMUSG00000043087
Gene Name olfactory receptor 855
Synonyms MOR148-1, GA_x6K02T2PVTD-13330461-13331399
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock # R8470 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 19582617-19586030 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 19584969 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 144 (L144R)
Ref Sequence ENSEMBL: ENSMUSP00000150218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061693] [ENSMUST00000215587]
AlphaFold Q7TRF8
Predicted Effect probably damaging
Transcript: ENSMUST00000061693
AA Change: L144R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000054790
Gene: ENSMUSG00000043087
AA Change: L144R

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 1.7e-54 PFAM
Pfam:7TM_GPCR_Srsx 37 182 5.2e-8 PFAM
Pfam:7tm_1 43 292 2.5e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215587
AA Change: L144R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A C 10: 82,290,480 F2232C probably damaging Het
Abraxas2 A T 7: 132,874,956 I142F probably damaging Het
Adamts16 A G 13: 70,836,377 Y56H probably damaging Het
Alms1 A G 6: 85,641,375 D2801G probably damaging Het
Anpep A G 7: 79,839,521 I301T probably benign Het
Atxn7l2 G A 3: 108,206,969 T159M probably benign Het
B130006D01Rik C T 11: 95,726,349 probably benign Het
Ccdc175 T C 12: 72,155,618 K301R probably damaging Het
Cecr2 A T 6: 120,756,933 Q627L probably benign Het
Cerkl C A 2: 79,342,407 M307I probably benign Het
Eif2ak4 A G 2: 118,462,726 I1254M probably damaging Het
Epha3 T C 16: 63,844,147 T37A probably benign Het
Fancm T C 12: 65,125,157 V1857A probably damaging Het
Gm20075 C A 13: 96,080,924 D136Y possibly damaging Het
Gm3486 T C 14: 41,484,581 probably null Het
Il1r2 T C 1: 40,123,256 V353A probably damaging Het
Irgq A T 7: 24,534,290 R519W probably damaging Het
Map1b T A 13: 99,516,442 S16C probably damaging Het
Myo9a T G 9: 59,832,290 C762G probably damaging Het
Nup107 A T 10: 117,770,469 V454E probably damaging Het
Olfr1181 A T 2: 88,423,884 I47N probably damaging Het
Olfr1564 A G 17: 33,215,894 V150A probably benign Het
Pcdha11 A G 18: 37,012,884 K676R probably benign Het
Pknox2 C T 9: 36,923,690 R161H probably damaging Het
Prr5l T C 2: 101,717,085 N365S probably benign Het
Prrg4 A G 2: 104,849,156 L8P probably damaging Het
Rasgrp2 T A 19: 6,403,565 probably null Het
Rtp4 A T 16: 23,610,077 H30L probably benign Het
Rxfp2 T G 5: 150,070,369 I632S possibly damaging Het
Sptbn1 C A 11: 30,120,758 E1533D possibly damaging Het
Ssbp1 A G 6: 40,478,007 I133M probably damaging Het
Stap1 A G 5: 86,094,743 I188V possibly damaging Het
Topaz1 T C 9: 122,774,108 M1040T probably benign Het
Trpm3 T C 19: 22,910,137 F877L possibly damaging Het
Ush1c A G 7: 46,209,250 L538P probably damaging Het
Zfp518a G A 19: 40,915,718 A1364T probably benign Het
Other mutations in Olfr855
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Olfr855 APN 9 19585320 missense possibly damaging 0.74
IGL01405:Olfr855 APN 9 19585205 missense probably benign 0.23
IGL01775:Olfr855 APN 9 19584705 missense probably benign 0.04
IGL01920:Olfr855 APN 9 19585022 missense probably benign 0.01
R0501:Olfr855 UTSW 9 19584618 missense probably damaging 1.00
R0600:Olfr855 UTSW 9 19585304 missense possibly damaging 0.47
R0667:Olfr855 UTSW 9 19585447 missense probably benign
R1769:Olfr855 UTSW 9 19585386 missense probably damaging 0.98
R3117:Olfr855 UTSW 9 19584941 missense probably damaging 0.99
R4002:Olfr855 UTSW 9 19584714 missense probably damaging 1.00
R4003:Olfr855 UTSW 9 19584714 missense probably damaging 1.00
R4043:Olfr855 UTSW 9 19584995 missense probably benign 0.16
R4243:Olfr855 UTSW 9 19584558 missense probably damaging 1.00
R4672:Olfr855 UTSW 9 19585430 missense possibly damaging 0.74
R4673:Olfr855 UTSW 9 19585430 missense possibly damaging 0.74
R4959:Olfr855 UTSW 9 19585208 missense probably benign
R4973:Olfr855 UTSW 9 19585208 missense probably benign
R5223:Olfr855 UTSW 9 19585026 missense probably benign 0.16
R5681:Olfr855 UTSW 9 19584899 missense probably damaging 1.00
R6005:Olfr855 UTSW 9 19584885 missense probably benign 0.45
R6017:Olfr855 UTSW 9 19585434 missense probably benign 0.00
R6145:Olfr855 UTSW 9 19584888 missense probably benign 0.02
R6615:Olfr855 UTSW 9 19584989 missense probably benign 0.05
R6771:Olfr855 UTSW 9 19585379 missense probably benign 0.16
R6969:Olfr855 UTSW 9 19584590 missense possibly damaging 0.77
R7239:Olfr855 UTSW 9 19585191 missense probably damaging 1.00
R7313:Olfr855 UTSW 9 19584642 missense probably damaging 1.00
R7361:Olfr855 UTSW 9 19584560 missense probably benign 0.00
R8112:Olfr855 UTSW 9 19584724 missense probably benign 0.44
R9155:Olfr855 UTSW 9 19585083 missense probably benign 0.00
R9187:Olfr855 UTSW 9 19584654 missense probably benign 0.03
R9422:Olfr855 UTSW 9 19584672
Predicted Primers PCR Primer
(F):5'- GACATTGGTTTAAGCACAGCC -3'
(R):5'- TTGCAACAAAGAGCACGATG -3'

Sequencing Primer
(F):5'- TTGGTTTAAGCACAGCCACAGTC -3'
(R):5'- AGAGCACGATGTTGTCAATTCG -3'
Posted On 2021-01-18