Incidental Mutation 'R8471:Pcdh12'
ID657046
Institutional Source Beutler Lab
Gene Symbol Pcdh12
Ensembl Gene ENSMUSG00000024440
Gene Nameprotocadherin 12
SynonymsVE-cadherin-2, vascular endothelial cadherin-2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8471 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location38267092-38284402 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38282255 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 606 (P606S)
Ref Sequence ENSEMBL: ENSMUSP00000025311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025311] [ENSMUST00000194012]
Predicted Effect probably benign
Transcript: ENSMUST00000025311
AA Change: P606S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000025311
Gene: ENSMUSG00000024440
AA Change: P606S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
CA 53 133 4.42e-2 SMART
CA 157 242 2.55e-17 SMART
CA 266 350 2.31e-24 SMART
CA 376 458 3.86e-26 SMART
CA 482 563 6.27e-26 SMART
CA 621 704 3.02e-2 SMART
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 960 975 N/A INTRINSIC
low complexity region 1032 1041 N/A INTRINSIC
low complexity region 1115 1125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194012
SMART Domains Protein: ENSMUSP00000141907
Gene: ENSMUSG00000024440

DomainStartEndE-ValueType
low complexity region 56 66 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein consists of an extracellular domain containing 6 cadherin repeats, a transmembrane domain and a cytoplasmic tail that differs from those of the classical cadherins. The gene localizes to the region on chromosome 5 where the protocadherin gene clusters reside. The exon organization of this transcript is similar to that of the gene cluster transcripts, notably the first large exon, but no significant sequence homology exists. The function of this cellular adhesion protein is undetermined but mouse protocadherin 12 does not bind catenins and appears to have no affect on cell migration or growth. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable, fertile and do not display any obvious histomorphological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik T A 1: 57,383,064 C200S probably damaging Het
Abca1 G A 4: 53,044,187 H1812Y probably damaging Het
Adgrv1 T A 13: 81,446,472 D4141V probably benign Het
Arhgef38 A T 3: 133,234,711 V38E probably damaging Het
Arl15 T A 13: 113,901,096 probably benign Het
Cwh43 T A 5: 73,434,301 L493Q probably damaging Het
Dnah7b C T 1: 46,099,490 H231Y possibly damaging Het
Eif2d C A 1: 131,164,418 Q309K probably benign Het
Epop A G 11: 97,629,247 V12A possibly damaging Het
Fkbp5 C T 17: 28,415,969 V189I probably benign Het
Ikzf2 T C 1: 69,539,340 M343V probably benign Het
Kdm5a T A 6: 120,430,231 L1469* probably null Het
Man2b2 A T 5: 36,821,839 W286R probably damaging Het
Naip5 G T 13: 100,221,645 Q1028K probably damaging Het
Nlrp1a T A 11: 71,123,059 D455V possibly damaging Het
Olfr1130 A G 2: 87,607,645 R86G probably damaging Het
Olfr312 A G 11: 58,831,771 M206V probably benign Het
Olfr392 A T 11: 73,814,483 F200I probably benign Het
Olfr977-ps1 A G 9: 39,974,605 S73P unknown Het
Plec A G 15: 76,186,420 V894A probably damaging Het
Ppp4r3a T C 12: 101,055,642 N333S probably benign Het
Ptger4 A T 15: 5,242,319 M273K probably damaging Het
Pzp T C 6: 128,487,448 D1372G probably benign Het
Rai14 T C 15: 10,575,159 K571R probably benign Het
Rarb T A 14: 16,548,456 probably benign Het
Ros1 A G 10: 52,120,982 V1198A probably benign Het
Ryr3 A G 2: 112,653,780 V3879A probably damaging Het
Serpinb6d A T 13: 33,664,154 I34F probably damaging Het
Slc44a2 T G 9: 21,341,969 I62S probably null Het
Snx9 T A 17: 5,890,090 W39R probably damaging Het
Tbcb A T 7: 30,231,675 S7T probably benign Het
Ttc21a C A 9: 119,963,176 probably null Het
Ttc7 G A 17: 87,294,026 G63R probably benign Het
Zdhhc3 A T 9: 123,100,375 V65D probably damaging Het
Zfp518b T C 5: 38,674,083 Y193C probably damaging Het
Zw10 T A 9: 49,071,614 I515N probably damaging Het
Other mutations in Pcdh12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Pcdh12 APN 18 38281457 missense probably benign
IGL00964:Pcdh12 APN 18 38282731 missense probably benign 0.27
IGL01105:Pcdh12 APN 18 38275347 missense probably damaging 1.00
IGL02011:Pcdh12 APN 18 38281420 missense probably damaging 1.00
IGL02234:Pcdh12 APN 18 38283535 missense probably damaging 1.00
IGL02452:Pcdh12 APN 18 38281693 missense probably benign 0.00
IGL03412:Pcdh12 APN 18 38283515 missense probably benign 0.24
R0729:Pcdh12 UTSW 18 38282464 missense probably benign 0.20
R1330:Pcdh12 UTSW 18 38281861 missense probably benign 0.13
R1394:Pcdh12 UTSW 18 38281189 critical splice donor site probably null
R1413:Pcdh12 UTSW 18 38283443 missense probably damaging 1.00
R1993:Pcdh12 UTSW 18 38282143 missense possibly damaging 0.62
R2115:Pcdh12 UTSW 18 38283986 missense probably damaging 1.00
R2567:Pcdh12 UTSW 18 38282096 missense probably damaging 1.00
R2926:Pcdh12 UTSW 18 38282390 missense probably damaging 0.99
R3810:Pcdh12 UTSW 18 38281237 missense probably damaging 1.00
R3813:Pcdh12 UTSW 18 38283614 nonsense probably null
R5275:Pcdh12 UTSW 18 38284101 utr 5 prime probably benign
R5400:Pcdh12 UTSW 18 38268898 missense probably damaging 1.00
R5523:Pcdh12 UTSW 18 38283139 missense probably damaging 1.00
R5539:Pcdh12 UTSW 18 38281744 missense possibly damaging 0.77
R5604:Pcdh12 UTSW 18 38268882 missense probably damaging 1.00
R6012:Pcdh12 UTSW 18 38283752 missense probably damaging 1.00
R6042:Pcdh12 UTSW 18 38281505 missense probably damaging 1.00
R6129:Pcdh12 UTSW 18 38277859 missense probably damaging 1.00
R6239:Pcdh12 UTSW 18 38282401 missense probably damaging 1.00
R6508:Pcdh12 UTSW 18 38281337 nonsense probably null
R7250:Pcdh12 UTSW 18 38281976 missense probably benign
R7259:Pcdh12 UTSW 18 38281624 missense probably benign 0.00
R7271:Pcdh12 UTSW 18 38283047 missense probably damaging 1.00
R7489:Pcdh12 UTSW 18 38281789 missense possibly damaging 0.77
R8103:Pcdh12 UTSW 18 38282159 missense probably damaging 1.00
R8157:Pcdh12 UTSW 18 38282797 missense probably benign
R8322:Pcdh12 UTSW 18 38281577 nonsense probably null
R8503:Pcdh12 UTSW 18 38282521 missense possibly damaging 0.86
R8510:Pcdh12 UTSW 18 38282056 missense possibly damaging 0.89
R8677:Pcdh12 UTSW 18 38282138 missense probably benign 0.01
Z1177:Pcdh12 UTSW 18 38282992 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGCTGGCATTGGTGACATTAATG -3'
(R):5'- TTGAGTTCCAGGTGATAGCAGAG -3'

Sequencing Primer
(F):5'- GGTGACATTAATGAATAGCTGCCCC -3'
(R):5'- TCGCATCCAGCATCTCGGTG -3'
Posted On2021-01-18