Incidental Mutation 'R8472:Pdp2'
ID657076
Institutional Source Beutler Lab
Gene Symbol Pdp2
Ensembl Gene ENSMUSG00000048371
Gene Namepyruvate dehyrogenase phosphatase catalytic subunit 2
Synonyms4833426J09Rik, LOC382051
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R8472 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location104591451-104599026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104594281 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 254 (E254G)
Ref Sequence ENSEMBL: ENSMUSP00000092821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059588]
Predicted Effect probably benign
Transcript: ENSMUST00000059588
AA Change: E254G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000092821
Gene: ENSMUSG00000048371
AA Change: E254G

DomainStartEndE-ValueType
PP2Cc 96 518 1.1e-92 SMART
PP2C_SIG 121 520 2.56e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a mitochondrial protein that functions as a phosphatase and is involved in the enzymatic resetting of the pyruvate dehydrogenase complex. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T A 7: 12,512,641 H21Q possibly damaging Het
Ccdc7a A G 8: 129,027,657 S152P probably damaging Het
Ccnj T C 19: 40,845,164 S222P probably damaging Het
Cdcp2 C T 4: 107,102,784 A132V probably damaging Het
Cnksr3 G T 10: 7,134,532 P71Q probably damaging Het
Col9a3 C T 2: 180,605,264 P185L probably damaging Het
Cpm T C 10: 117,679,978 V319A probably damaging Het
Ctxn2 A G 2: 125,147,608 I52V possibly damaging Het
Cyp2c66 A T 19: 39,176,577 H334L probably benign Het
Dab1 A G 4: 104,479,242 K12E possibly damaging Het
Emsy T C 7: 98,654,830 probably benign Het
Etv4 G T 11: 101,784,001 D56E probably damaging Het
Exoc3l2 C T 7: 19,481,265 R484* probably null Het
Extl1 A G 4: 134,371,292 C143R probably benign Het
Fat3 T C 9: 16,375,267 I987V possibly damaging Het
Fbn1 A C 2: 125,309,802 C2511G probably damaging Het
Fer T A 17: 63,973,149 S72T probably benign Het
Gdf2 A G 14: 33,944,840 D173G probably damaging Het
Gm11639 A T 11: 104,818,637 D1815V probably benign Het
Gm6614 T G 6: 142,003,389 H87P probably damaging Het
Grhl3 T C 4: 135,556,865 E222G probably benign Het
Gria1 A T 11: 57,327,584 M819L probably benign Het
Gsap A T 5: 21,222,434 R187* probably null Het
Heatr6 A G 11: 83,765,853 N314D probably benign Het
Hspd1 T C 1: 55,078,346 D555G probably benign Het
Ighv3-4 T C 12: 114,254,029 Y8C probably benign Het
Lcmt2 A G 2: 121,140,248 V118A probably damaging Het
Lmf2 T C 15: 89,354,802 E37G possibly damaging Het
Macf1 A G 4: 123,453,002 L1161P probably damaging Het
Mbip T A 12: 56,330,269 probably null Het
Mgam A T 6: 40,694,526 probably null Het
Mmrn1 G A 6: 60,988,396 S1136N probably damaging Het
Mms22l T C 4: 24,502,943 V73A possibly damaging Het
Mtbp C T 15: 55,586,352 L24F probably damaging Het
Ncr1 T A 7: 4,338,121 I37N probably benign Het
Nkx3-1 A G 14: 69,192,058 N175S probably damaging Het
Nlrp4f A G 13: 65,194,331 I500T possibly damaging Het
Olfr397 C T 11: 73,965,397 S263L possibly damaging Het
Olfr518 T A 7: 108,880,766 Q280L possibly damaging Het
Olfr820 A G 10: 130,017,576 T72A probably damaging Het
Pcdha2 A G 18: 36,941,272 D652G probably damaging Het
Pde6a T A 18: 61,220,946 N114K probably damaging Het
Pip5kl1 T C 2: 32,580,006 V241A probably benign Het
Prkdc T A 16: 15,651,536 D168E probably damaging Het
Psg27 A T 7: 18,562,090 H143Q probably benign Het
Serpina16 T A 12: 103,672,537 I264F probably benign Het
Slc25a41 G A 17: 57,041,582 H4Y probably benign Het
Smc3 T G 19: 53,628,711 H518Q probably benign Het
Snrpb G T 2: 130,173,122 T158K probably damaging Het
Sobp A G 10: 43,022,396 F398L probably damaging Het
Spidr T A 16: 16,140,727 Q57L probably benign Het
Srd5a3 T G 5: 76,149,801 V26G possibly damaging Het
Stx17 A G 4: 48,166,972 T131A probably benign Het
Susd1 A G 4: 59,332,985 L553P possibly damaging Het
Tbc1d30 C A 10: 121,351,104 G59C probably benign Het
Tekt1 T C 11: 72,352,024 D219G possibly damaging Het
Trav9d-1 A T 14: 52,792,706 D89V possibly damaging Het
Trim34b T C 7: 104,331,338 I211T probably benign Het
Vmn1r25 A T 6: 57,978,546 L253M possibly damaging Het
Vmn1r56 C T 7: 5,195,905 V238M probably damaging Het
Wipf3 A G 6: 54,489,085 I443V probably benign Het
Other mutations in Pdp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Pdp2 APN 8 104594197 missense probably benign
IGL01771:Pdp2 APN 8 104594122 missense probably benign 0.06
IGL01946:Pdp2 APN 8 104594192 missense probably benign 0.00
IGL02313:Pdp2 APN 8 104594899 missense probably benign 0.44
IGL02588:Pdp2 APN 8 104594904 missense possibly damaging 0.73
IGL02981:Pdp2 APN 8 104593635 missense probably benign 0.00
R0456:Pdp2 UTSW 8 104593789 missense probably damaging 1.00
R1260:Pdp2 UTSW 8 104594617 missense probably damaging 0.96
R1974:Pdp2 UTSW 8 104593906 missense probably benign
R3008:Pdp2 UTSW 8 104594266 missense probably benign 0.08
R4580:Pdp2 UTSW 8 104594944 missense probably damaging 1.00
R4655:Pdp2 UTSW 8 104594536 missense probably benign 0.03
R5677:Pdp2 UTSW 8 104594688 missense probably damaging 1.00
R6813:Pdp2 UTSW 8 104594499 missense probably damaging 1.00
R8176:Pdp2 UTSW 8 104595055 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGGAAAACATGAAGCCTTTGC -3'
(R):5'- CGTTGTGGTCACAGGTAAGAGG -3'

Sequencing Primer
(F):5'- ATCCTGCGTTGGCTCAAG -3'
(R):5'- GTAAACATGACCAGGCACCGTTTTC -3'
Posted On2021-01-18