Incidental Mutation 'R8472:Serpina16'
ID 657091
Institutional Source Beutler Lab
Gene Symbol Serpina16
Ensembl Gene ENSMUSG00000071179
Gene Name serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 16
Synonyms LOC194604, Gm46
MMRRC Submission 067916-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.052) question?
Stock # R8472 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 103635067-103642398 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 103638796 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 264 (I264F)
Ref Sequence ENSEMBL: ENSMUSP00000126933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095451] [ENSMUST00000164148]
AlphaFold D3Z660
Predicted Effect probably benign
Transcript: ENSMUST00000095451
AA Change: I264F

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000093103
Gene: ENSMUSG00000071179
AA Change: I264F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SERPIN 52 407 6.36e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164148
AA Change: I264F

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000126933
Gene: ENSMUSG00000071179
AA Change: I264F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SERPIN 52 407 6.36e-68 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T A 7: 12,246,568 (GRCm39) H21Q possibly damaging Het
Ccdc7a A G 8: 129,754,138 (GRCm39) S152P probably damaging Het
Ccnj T C 19: 40,833,608 (GRCm39) S222P probably damaging Het
Cdcp2 C T 4: 106,959,981 (GRCm39) A132V probably damaging Het
Cnksr3 G T 10: 7,084,532 (GRCm39) P71Q probably damaging Het
Col9a3 C T 2: 180,247,057 (GRCm39) P185L probably damaging Het
Cpm T C 10: 117,515,883 (GRCm39) V319A probably damaging Het
Ctxn2 A G 2: 124,989,528 (GRCm39) I52V possibly damaging Het
Cyp2c66 A T 19: 39,165,021 (GRCm39) H334L probably benign Het
Dab1 A G 4: 104,336,439 (GRCm39) K12E possibly damaging Het
Efcab3 A T 11: 104,709,463 (GRCm39) D1815V probably benign Het
Emsy T C 7: 98,304,037 (GRCm39) probably benign Het
Etv4 G T 11: 101,674,827 (GRCm39) D56E probably damaging Het
Exoc3l2 C T 7: 19,215,190 (GRCm39) R484* probably null Het
Extl1 A G 4: 134,098,603 (GRCm39) C143R probably benign Het
Fat3 T C 9: 16,286,563 (GRCm39) I987V possibly damaging Het
Fbn1 A C 2: 125,151,722 (GRCm39) C2511G probably damaging Het
Fer T A 17: 64,280,144 (GRCm39) S72T probably benign Het
Gdf2 A G 14: 33,666,797 (GRCm39) D173G probably damaging Het
Grhl3 T C 4: 135,284,176 (GRCm39) E222G probably benign Het
Gria1 A T 11: 57,218,410 (GRCm39) M819L probably benign Het
Gsap A T 5: 21,427,432 (GRCm39) R187* probably null Het
Heatr6 A G 11: 83,656,679 (GRCm39) N314D probably benign Het
Hspd1 T C 1: 55,117,505 (GRCm39) D555G probably benign Het
Ighv3-4 T C 12: 114,217,649 (GRCm39) Y8C probably benign Het
Lcmt2 A G 2: 120,970,729 (GRCm39) V118A probably damaging Het
Lmf2 T C 15: 89,239,005 (GRCm39) E37G possibly damaging Het
Macf1 A G 4: 123,346,795 (GRCm39) L1161P probably damaging Het
Mbip T A 12: 56,377,054 (GRCm39) probably null Het
Mgam A T 6: 40,671,460 (GRCm39) probably null Het
Mmrn1 G A 6: 60,965,380 (GRCm39) S1136N probably damaging Het
Mms22l T C 4: 24,502,943 (GRCm39) V73A possibly damaging Het
Mtbp C T 15: 55,449,748 (GRCm39) L24F probably damaging Het
Ncr1 T A 7: 4,341,120 (GRCm39) I37N probably benign Het
Nkx3-1 A G 14: 69,429,507 (GRCm39) N175S probably damaging Het
Nlrp4f A G 13: 65,342,145 (GRCm39) I500T possibly damaging Het
Or10a3 T A 7: 108,479,973 (GRCm39) Q280L possibly damaging Het
Or1e1f C T 11: 73,856,223 (GRCm39) S263L possibly damaging Het
Or6c33 A G 10: 129,853,445 (GRCm39) T72A probably damaging Het
Pcdha2 A G 18: 37,074,325 (GRCm39) D652G probably damaging Het
Pde6a T A 18: 61,354,018 (GRCm39) N114K probably damaging Het
Pdp2 A G 8: 105,320,913 (GRCm39) E254G probably benign Het
Pip5kl1 T C 2: 32,470,018 (GRCm39) V241A probably benign Het
Prkdc T A 16: 15,469,400 (GRCm39) D168E probably damaging Het
Psg27 A T 7: 18,296,015 (GRCm39) H143Q probably benign Het
Slc25a41 G A 17: 57,348,582 (GRCm39) H4Y probably benign Het
Slco1a8 T G 6: 141,949,115 (GRCm39) H87P probably damaging Het
Smc3 T G 19: 53,617,142 (GRCm39) H518Q probably benign Het
Snrpb G T 2: 130,015,042 (GRCm39) T158K probably damaging Het
Sobp A G 10: 42,898,392 (GRCm39) F398L probably damaging Het
Spidr T A 16: 15,958,591 (GRCm39) Q57L probably benign Het
Srd5a3 T G 5: 76,297,648 (GRCm39) V26G possibly damaging Het
Stx17 A G 4: 48,166,972 (GRCm39) T131A probably benign Het
Susd1 A G 4: 59,332,985 (GRCm39) L553P possibly damaging Het
Tbc1d30 C A 10: 121,187,009 (GRCm39) G59C probably benign Het
Tekt1 T C 11: 72,242,850 (GRCm39) D219G possibly damaging Het
Trav9d-1 A T 14: 53,030,163 (GRCm39) D89V possibly damaging Het
Trim34b T C 7: 103,980,545 (GRCm39) I211T probably benign Het
Vmn1r25 A T 6: 57,955,531 (GRCm39) L253M possibly damaging Het
Vmn1r56 C T 7: 5,198,904 (GRCm39) V238M probably damaging Het
Wipf3 A G 6: 54,466,070 (GRCm39) I443V probably benign Het
Other mutations in Serpina16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02230:Serpina16 APN 12 103,641,561 (GRCm39) missense probably damaging 1.00
IGL02960:Serpina16 APN 12 103,641,638 (GRCm39) missense probably benign 0.13
R2086:Serpina16 UTSW 12 103,641,521 (GRCm39) missense probably damaging 1.00
R4092:Serpina16 UTSW 12 103,638,836 (GRCm39) missense probably benign 0.01
R5027:Serpina16 UTSW 12 103,641,262 (GRCm39) nonsense probably null
R5054:Serpina16 UTSW 12 103,641,189 (GRCm39) missense probably benign 0.08
R6736:Serpina16 UTSW 12 103,635,191 (GRCm39) missense possibly damaging 0.83
R7016:Serpina16 UTSW 12 103,641,630 (GRCm39) missense probably benign 0.00
R7283:Serpina16 UTSW 12 103,638,691 (GRCm39) critical splice donor site probably null
R9701:Serpina16 UTSW 12 103,638,873 (GRCm39) missense probably benign 0.03
Z1177:Serpina16 UTSW 12 103,641,362 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTCCAGATCCCGTGTCATGC -3'
(R):5'- GATTCCTGTGCACTTTCTTATCAGG -3'

Sequencing Primer
(F):5'- GTGTCATGCCCCAAAGACTTAAAAGG -3'
(R):5'- GTGCACTTTCTTATCAGGAAAATGG -3'
Posted On 2021-01-18