Incidental Mutation 'R8472:Gdf2'
ID 657094
Institutional Source Beutler Lab
Gene Symbol Gdf2
Ensembl Gene ENSMUSG00000072625
Gene Name growth differentiation factor 2
Synonyms Bmp9
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8472 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 33941039-33947198 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 33944840 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 173 (D173G)
Ref Sequence ENSEMBL: ENSMUSP00000098286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100720]
AlphaFold Q9WV56
PDB Structure Pro-bone morphogenetic protein 9 [X-RAY DIFFRACTION]
non-latent pro-bone morphogenetic protein 9 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000100720
AA Change: D173G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098286
Gene: ENSMUSG00000072625
AA Change: D173G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
Pfam:TGFb_propeptide 55 256 8.5e-21 PFAM
TGFB 326 428 3.83e-56 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates cartilage and bone development, angiogenesis and differentiation of cholinergic central nervous system neurons. Homozygous null mice exhibit malformations of the vasculature and skeleton. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show arteriovenous malformations, skeletal anomalies, and abnormal retinal vasculature after anti-BMP10-antibody treatment. Homozygotes for a different null allele show abnormal retinal and tracheal vasculature and tracheal lymphatic vessels after anti-BMP10 treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T A 7: 12,512,641 H21Q possibly damaging Het
Ccdc7a A G 8: 129,027,657 S152P probably damaging Het
Ccnj T C 19: 40,845,164 S222P probably damaging Het
Cdcp2 C T 4: 107,102,784 A132V probably damaging Het
Cnksr3 G T 10: 7,134,532 P71Q probably damaging Het
Col9a3 C T 2: 180,605,264 P185L probably damaging Het
Cpm T C 10: 117,679,978 V319A probably damaging Het
Ctxn2 A G 2: 125,147,608 I52V possibly damaging Het
Cyp2c66 A T 19: 39,176,577 H334L probably benign Het
Dab1 A G 4: 104,479,242 K12E possibly damaging Het
Emsy T C 7: 98,654,830 probably benign Het
Etv4 G T 11: 101,784,001 D56E probably damaging Het
Exoc3l2 C T 7: 19,481,265 R484* probably null Het
Extl1 A G 4: 134,371,292 C143R probably benign Het
Fat3 T C 9: 16,375,267 I987V possibly damaging Het
Fbn1 A C 2: 125,309,802 C2511G probably damaging Het
Fer T A 17: 63,973,149 S72T probably benign Het
Gm11639 A T 11: 104,818,637 D1815V probably benign Het
Gm6614 T G 6: 142,003,389 H87P probably damaging Het
Grhl3 T C 4: 135,556,865 E222G probably benign Het
Gria1 A T 11: 57,327,584 M819L probably benign Het
Gsap A T 5: 21,222,434 R187* probably null Het
Heatr6 A G 11: 83,765,853 N314D probably benign Het
Hspd1 T C 1: 55,078,346 D555G probably benign Het
Ighv3-4 T C 12: 114,254,029 Y8C probably benign Het
Lcmt2 A G 2: 121,140,248 V118A probably damaging Het
Lmf2 T C 15: 89,354,802 E37G possibly damaging Het
Macf1 A G 4: 123,453,002 L1161P probably damaging Het
Mbip T A 12: 56,330,269 probably null Het
Mgam A T 6: 40,694,526 probably null Het
Mmrn1 G A 6: 60,988,396 S1136N probably damaging Het
Mms22l T C 4: 24,502,943 V73A possibly damaging Het
Mtbp C T 15: 55,586,352 L24F probably damaging Het
Ncr1 T A 7: 4,338,121 I37N probably benign Het
Nkx3-1 A G 14: 69,192,058 N175S probably damaging Het
Nlrp4f A G 13: 65,194,331 I500T possibly damaging Het
Olfr397 C T 11: 73,965,397 S263L possibly damaging Het
Olfr518 T A 7: 108,880,766 Q280L possibly damaging Het
Olfr820 A G 10: 130,017,576 T72A probably damaging Het
Pcdha2 A G 18: 36,941,272 D652G probably damaging Het
Pde6a T A 18: 61,220,946 N114K probably damaging Het
Pdp2 A G 8: 104,594,281 E254G probably benign Het
Pip5kl1 T C 2: 32,580,006 V241A probably benign Het
Prkdc T A 16: 15,651,536 D168E probably damaging Het
Psg27 A T 7: 18,562,090 H143Q probably benign Het
Serpina16 T A 12: 103,672,537 I264F probably benign Het
Slc25a41 G A 17: 57,041,582 H4Y probably benign Het
Smc3 T G 19: 53,628,711 H518Q probably benign Het
Snrpb G T 2: 130,173,122 T158K probably damaging Het
Sobp A G 10: 43,022,396 F398L probably damaging Het
Spidr T A 16: 16,140,727 Q57L probably benign Het
Srd5a3 T G 5: 76,149,801 V26G possibly damaging Het
Stx17 A G 4: 48,166,972 T131A probably benign Het
Susd1 A G 4: 59,332,985 L553P possibly damaging Het
Tbc1d30 C A 10: 121,351,104 G59C probably benign Het
Tekt1 T C 11: 72,352,024 D219G possibly damaging Het
Trav9d-1 A T 14: 52,792,706 D89V possibly damaging Het
Trim34b T C 7: 104,331,338 I211T probably benign Het
Vmn1r25 A T 6: 57,978,546 L253M possibly damaging Het
Vmn1r56 C T 7: 5,195,905 V238M probably damaging Het
Wipf3 A G 6: 54,489,085 I443V probably benign Het
Other mutations in Gdf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0557:Gdf2 UTSW 14 33941221 missense probably damaging 1.00
R0631:Gdf2 UTSW 14 33941221 missense probably damaging 1.00
R0739:Gdf2 UTSW 14 33941221 missense probably damaging 1.00
R2142:Gdf2 UTSW 14 33945241 missense probably benign
R2292:Gdf2 UTSW 14 33945188 missense possibly damaging 0.60
R3615:Gdf2 UTSW 14 33944957 missense probably damaging 1.00
R3616:Gdf2 UTSW 14 33944957 missense probably damaging 1.00
R3974:Gdf2 UTSW 14 33944834 missense probably damaging 0.97
R3975:Gdf2 UTSW 14 33944834 missense probably damaging 0.97
R3976:Gdf2 UTSW 14 33944834 missense probably damaging 0.97
R4665:Gdf2 UTSW 14 33945451 missense probably damaging 1.00
R5007:Gdf2 UTSW 14 33944906 missense probably benign 0.02
R5227:Gdf2 UTSW 14 33941494 critical splice donor site probably null
R5253:Gdf2 UTSW 14 33945307 missense probably benign 0.14
R5259:Gdf2 UTSW 14 33944831 missense probably benign 0.01
R6286:Gdf2 UTSW 14 33945100 missense probably damaging 1.00
R7644:Gdf2 UTSW 14 33944890 missense probably benign 0.00
R9067:Gdf2 UTSW 14 33941454 missense probably benign 0.20
Z1177:Gdf2 UTSW 14 33945317 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTTCAGATGCTATATCGACAGCTG -3'
(R):5'- AACCTGGAGGGACACTGATG -3'

Sequencing Primer
(F):5'- TATATCGACAGCTGCCACGGAG -3'
(R):5'- ATGTCCAGTGTGTCACAGC -3'
Posted On 2021-01-18