Mutagenetix > Incidental Mutation

Incidental Mutation 'R8472:Gdf2'

657094

Institutional Source

Beutler Lab

Gene Symbol

Gdf2

Ensembl Gene

ENSMUSG00000072625

Gene Name

growth differentiation factor 2

Synonyms

Bmp9

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8472 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

33941039-33947198 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 33944840 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 173 (D173G)

Ref Sequence

ENSEMBL: ENSMUSP00000098286 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100720]

AlphaFold

Q9WV56

PDB Structure

Pro-bone morphogenetic protein 9 [X-RAY DIFFRACTION]
non-latent pro-bone morphogenetic protein 9 [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000100720
AA Change: D173G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000098286
Gene: ENSMUSG00000072625
AA Change: D173G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
low complexity region	39	50	N/A	INTRINSIC
Pfam:TGFb_propeptide	55	256	8.5e-21	PFAM
TGFB	326	428	3.83e-56	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates cartilage and bone development, angiogenesis and differentiation of cholinergic central nervous system neurons. Homozygous null mice exhibit malformations of the vasculature and skeleton. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show arteriovenous malformations, skeletal anomalies, and abnormal retinal vasculature after anti-BMP10-antibody treatment. Homozygotes for a different null allele show abnormal retinal and tracheal vasculature and tracheal lymphatic vessels after anti-BMP10 treatment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900092C05Rik	T	A	7: 12,512,641	H21Q	possibly damaging	Het
Ccdc7a	A	G	8: 129,027,657	S152P	probably damaging	Het
Ccnj	T	C	19: 40,845,164	S222P	probably damaging	Het
Cdcp2	C	T	4: 107,102,784	A132V	probably damaging	Het
Cnksr3	G	T	10: 7,134,532	P71Q	probably damaging	Het
Col9a3	C	T	2: 180,605,264	P185L	probably damaging	Het
Cpm	T	C	10: 117,679,978	V319A	probably damaging	Het
Ctxn2	A	G	2: 125,147,608	I52V	possibly damaging	Het
Cyp2c66	A	T	19: 39,176,577	H334L	probably benign	Het
Dab1	A	G	4: 104,479,242	K12E	possibly damaging	Het
Emsy	T	C	7: 98,654,830		probably benign	Het
Etv4	G	T	11: 101,784,001	D56E	probably damaging	Het
Exoc3l2	C	T	7: 19,481,265	R484*	probably null	Het
Extl1	A	G	4: 134,371,292	C143R	probably benign	Het
Fat3	T	C	9: 16,375,267	I987V	possibly damaging	Het
Fbn1	A	C	2: 125,309,802	C2511G	probably damaging	Het
Fer	T	A	17: 63,973,149	S72T	probably benign	Het
Gm11639	A	T	11: 104,818,637	D1815V	probably benign	Het
Gm6614	T	G	6: 142,003,389	H87P	probably damaging	Het
Grhl3	T	C	4: 135,556,865	E222G	probably benign	Het
Gria1	A	T	11: 57,327,584	M819L	probably benign	Het
Gsap	A	T	5: 21,222,434	R187*	probably null	Het
Heatr6	A	G	11: 83,765,853	N314D	probably benign	Het
Hspd1	T	C	1: 55,078,346	D555G	probably benign	Het
Ighv3-4	T	C	12: 114,254,029	Y8C	probably benign	Het
Lcmt2	A	G	2: 121,140,248	V118A	probably damaging	Het
Lmf2	T	C	15: 89,354,802	E37G	possibly damaging	Het
Macf1	A	G	4: 123,453,002	L1161P	probably damaging	Het
Mbip	T	A	12: 56,330,269		probably null	Het
Mgam	A	T	6: 40,694,526		probably null	Het
Mmrn1	G	A	6: 60,988,396	S1136N	probably damaging	Het
Mms22l	T	C	4: 24,502,943	V73A	possibly damaging	Het
Mtbp	C	T	15: 55,586,352	L24F	probably damaging	Het
Ncr1	T	A	7: 4,338,121	I37N	probably benign	Het
Nkx3-1	A	G	14: 69,192,058	N175S	probably damaging	Het
Nlrp4f	A	G	13: 65,194,331	I500T	possibly damaging	Het
Olfr397	C	T	11: 73,965,397	S263L	possibly damaging	Het
Olfr518	T	A	7: 108,880,766	Q280L	possibly damaging	Het
Olfr820	A	G	10: 130,017,576	T72A	probably damaging	Het
Pcdha2	A	G	18: 36,941,272	D652G	probably damaging	Het
Pde6a	T	A	18: 61,220,946	N114K	probably damaging	Het
Pdp2	A	G	8: 104,594,281	E254G	probably benign	Het
Pip5kl1	T	C	2: 32,580,006	V241A	probably benign	Het
Prkdc	T	A	16: 15,651,536	D168E	probably damaging	Het
Psg27	A	T	7: 18,562,090	H143Q	probably benign	Het
Serpina16	T	A	12: 103,672,537	I264F	probably benign	Het
Slc25a41	G	A	17: 57,041,582	H4Y	probably benign	Het
Smc3	T	G	19: 53,628,711	H518Q	probably benign	Het
Snrpb	G	T	2: 130,173,122	T158K	probably damaging	Het
Sobp	A	G	10: 43,022,396	F398L	probably damaging	Het
Spidr	T	A	16: 16,140,727	Q57L	probably benign	Het
Srd5a3	T	G	5: 76,149,801	V26G	possibly damaging	Het
Stx17	A	G	4: 48,166,972	T131A	probably benign	Het
Susd1	A	G	4: 59,332,985	L553P	possibly damaging	Het
Tbc1d30	C	A	10: 121,351,104	G59C	probably benign	Het
Tekt1	T	C	11: 72,352,024	D219G	possibly damaging	Het
Trav9d-1	A	T	14: 52,792,706	D89V	possibly damaging	Het
Trim34b	T	C	7: 104,331,338	I211T	probably benign	Het
Vmn1r25	A	T	6: 57,978,546	L253M	possibly damaging	Het
Vmn1r56	C	T	7: 5,195,905	V238M	probably damaging	Het
Wipf3	A	G	6: 54,489,085	I443V	probably benign	Het

Other mutations in Gdf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0557:Gdf2	UTSW	14	33941221	missense	probably damaging	1.00
R0631:Gdf2	UTSW	14	33941221	missense	probably damaging	1.00
R0739:Gdf2	UTSW	14	33941221	missense	probably damaging	1.00
R2142:Gdf2	UTSW	14	33945241	missense	probably benign
R2292:Gdf2	UTSW	14	33945188	missense	possibly damaging	0.60
R3615:Gdf2	UTSW	14	33944957	missense	probably damaging	1.00
R3616:Gdf2	UTSW	14	33944957	missense	probably damaging	1.00
R3974:Gdf2	UTSW	14	33944834	missense	probably damaging	0.97
R3975:Gdf2	UTSW	14	33944834	missense	probably damaging	0.97
R3976:Gdf2	UTSW	14	33944834	missense	probably damaging	0.97
R4665:Gdf2	UTSW	14	33945451	missense	probably damaging	1.00
R5007:Gdf2	UTSW	14	33944906	missense	probably benign	0.02
R5227:Gdf2	UTSW	14	33941494	critical splice donor site	probably null
R5253:Gdf2	UTSW	14	33945307	missense	probably benign	0.14
R5259:Gdf2	UTSW	14	33944831	missense	probably benign	0.01
R6286:Gdf2	UTSW	14	33945100	missense	probably damaging	1.00
R7644:Gdf2	UTSW	14	33944890	missense	probably benign	0.00
R9067:Gdf2	UTSW	14	33941454	missense	probably benign	0.20
R9525:Gdf2	UTSW	14	33945607	makesense	probably null
Z1177:Gdf2	UTSW	14	33945317	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TTTCAGATGCTATATCGACAGCTG -3'
(R):5'- AACCTGGAGGGACACTGATG -3'

Sequencing Primer
(F):5'- TATATCGACAGCTGCCACGGAG -3'
(R):5'- ATGTCCAGTGTGTCACAGC -3'

Posted On

2021-01-18