Mutagenetix > Incidental Mutation

Incidental Mutation 'R8472:Pde6a'

657104

Institutional Source

Beutler Lab

Gene Symbol

Pde6a

Ensembl Gene

ENSMUSG00000024575

Gene Name

phosphodiesterase 6A, cGMP-specific, rod, alpha

Synonyms

Pdea

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8472 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

61220482-61289924 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 61220946 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 114 (N114K)

Ref Sequence

ENSEMBL: ENSMUSP00000025468 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025468]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000025468
AA Change: N114K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000025468
Gene: ENSMUSG00000024575
AA Change: N114K

Domain	Start	End	E-Value	Type
GAF	73	232	1.36e-21	SMART
GAF	254	441	3.21e-23	SMART
low complexity region	478	495	N/A	INTRINSIC
Blast:HDc	496	540	3e-11	BLAST
HDc	556	734	6.95e-8	SMART
Blast:HDc	759	786	1e-8	BLAST
low complexity region	817	837	N/A	INTRINSIC
low complexity region	839	853	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cyclic-GMP (cGMP)-specific phosphodiesterase 6A alpha subunit, expressed in cells of the retinal rod outer segment. The phosphodiesterase 6 holoenzyme is a heterotrimer composed of an alpha, beta, and two gamma subunits. cGMP is an important regulator of rod cell membrane current, and its dynamic concentration is established by phosphodiesterase 6A cGMP hydrolysis and guanylate cyclase cGMP synthesis. The protein is a subunit of a key phototransduction enzyme and participates in processes of transmission and amplification of the visual signal. Mutations in this gene have been identified as one cause of autosomal recessive retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have retinal degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900092C05Rik	T	A	7: 12,512,641	H21Q	possibly damaging	Het
Ccdc7a	A	G	8: 129,027,657	S152P	probably damaging	Het
Ccnj	T	C	19: 40,845,164	S222P	probably damaging	Het
Cdcp2	C	T	4: 107,102,784	A132V	probably damaging	Het
Cnksr3	G	T	10: 7,134,532	P71Q	probably damaging	Het
Col9a3	C	T	2: 180,605,264	P185L	probably damaging	Het
Cpm	T	C	10: 117,679,978	V319A	probably damaging	Het
Ctxn2	A	G	2: 125,147,608	I52V	possibly damaging	Het
Cyp2c66	A	T	19: 39,176,577	H334L	probably benign	Het
Dab1	A	G	4: 104,479,242	K12E	possibly damaging	Het
Emsy	T	C	7: 98,654,830		probably benign	Het
Etv4	G	T	11: 101,784,001	D56E	probably damaging	Het
Exoc3l2	C	T	7: 19,481,265	R484*	probably null	Het
Extl1	A	G	4: 134,371,292	C143R	probably benign	Het
Fat3	T	C	9: 16,375,267	I987V	possibly damaging	Het
Fbn1	A	C	2: 125,309,802	C2511G	probably damaging	Het
Fer	T	A	17: 63,973,149	S72T	probably benign	Het
Gdf2	A	G	14: 33,944,840	D173G	probably damaging	Het
Gm11639	A	T	11: 104,818,637	D1815V	probably benign	Het
Gm6614	T	G	6: 142,003,389	H87P	probably damaging	Het
Grhl3	T	C	4: 135,556,865	E222G	probably benign	Het
Gria1	A	T	11: 57,327,584	M819L	probably benign	Het
Gsap	A	T	5: 21,222,434	R187*	probably null	Het
Heatr6	A	G	11: 83,765,853	N314D	probably benign	Het
Hspd1	T	C	1: 55,078,346	D555G	probably benign	Het
Ighv3-4	T	C	12: 114,254,029	Y8C	probably benign	Het
Lcmt2	A	G	2: 121,140,248	V118A	probably damaging	Het
Lmf2	T	C	15: 89,354,802	E37G	possibly damaging	Het
Macf1	A	G	4: 123,453,002	L1161P	probably damaging	Het
Mbip	T	A	12: 56,330,269		probably null	Het
Mgam	A	T	6: 40,694,526		probably null	Het
Mmrn1	G	A	6: 60,988,396	S1136N	probably damaging	Het
Mms22l	T	C	4: 24,502,943	V73A	possibly damaging	Het
Mtbp	C	T	15: 55,586,352	L24F	probably damaging	Het
Ncr1	T	A	7: 4,338,121	I37N	probably benign	Het
Nkx3-1	A	G	14: 69,192,058	N175S	probably damaging	Het
Nlrp4f	A	G	13: 65,194,331	I500T	possibly damaging	Het
Olfr397	C	T	11: 73,965,397	S263L	possibly damaging	Het
Olfr518	T	A	7: 108,880,766	Q280L	possibly damaging	Het
Olfr820	A	G	10: 130,017,576	T72A	probably damaging	Het
Pcdha2	A	G	18: 36,941,272	D652G	probably damaging	Het
Pdp2	A	G	8: 104,594,281	E254G	probably benign	Het
Pip5kl1	T	C	2: 32,580,006	V241A	probably benign	Het
Prkdc	T	A	16: 15,651,536	D168E	probably damaging	Het
Psg27	A	T	7: 18,562,090	H143Q	probably benign	Het
Serpina16	T	A	12: 103,672,537	I264F	probably benign	Het
Slc25a41	G	A	17: 57,041,582	H4Y	probably benign	Het
Smc3	T	G	19: 53,628,711	H518Q	probably benign	Het
Snrpb	G	T	2: 130,173,122	T158K	probably damaging	Het
Sobp	A	G	10: 43,022,396	F398L	probably damaging	Het
Spidr	T	A	16: 16,140,727	Q57L	probably benign	Het
Srd5a3	T	G	5: 76,149,801	V26G	possibly damaging	Het
Stx17	A	G	4: 48,166,972	T131A	probably benign	Het
Susd1	A	G	4: 59,332,985	L553P	possibly damaging	Het
Tbc1d30	C	A	10: 121,351,104	G59C	probably benign	Het
Tekt1	T	C	11: 72,352,024	D219G	possibly damaging	Het
Trav9d-1	A	T	14: 52,792,706	D89V	possibly damaging	Het
Trim34b	T	C	7: 104,331,338	I211T	probably benign	Het
Vmn1r25	A	T	6: 57,978,546	L253M	possibly damaging	Het
Vmn1r56	C	T	7: 5,195,905	V238M	probably damaging	Het
Wipf3	A	G	6: 54,489,085	I443V	probably benign	Het

Other mutations in Pde6a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00583:Pde6a	APN	18	61257268	missense	probably damaging	1.00
IGL00896:Pde6a	APN	18	61220792	missense	possibly damaging	0.94
IGL01595:Pde6a	APN	18	61281528	missense	probably damaging	0.98
IGL02971:Pde6a	APN	18	61264255	missense	probably damaging	1.00
caffeinated	UTSW	18	61220606	start codon destroyed	probably null	0.95
R0219:Pde6a	UTSW	18	61285935	missense	possibly damaging	0.57
R0968:Pde6a	UTSW	18	61253738	missense	probably damaging	0.99
R1304:Pde6a	UTSW	18	61258293	missense	probably damaging	0.99
R1498:Pde6a	UTSW	18	61232860	missense	possibly damaging	0.73
R1542:Pde6a	UTSW	18	61257045	missense	possibly damaging	0.93
R1734:Pde6a	UTSW	18	61285965	missense	probably damaging	1.00
R1795:Pde6a	UTSW	18	61257212	missense	probably damaging	1.00
R2173:Pde6a	UTSW	18	61254382	missense	probably damaging	1.00
R2280:Pde6a	UTSW	18	61262434	missense	probably damaging	1.00
R2281:Pde6a	UTSW	18	61262434	missense	probably damaging	1.00
R3617:Pde6a	UTSW	18	61231503	splice site	probably benign
R4620:Pde6a	UTSW	18	61262492	missense	probably damaging	1.00
R4727:Pde6a	UTSW	18	61231489	missense	probably benign	0.02
R4863:Pde6a	UTSW	18	61245592	missense	probably damaging	1.00
R4904:Pde6a	UTSW	18	61265034	missense	probably benign	0.08
R4945:Pde6a	UTSW	18	61234718	missense	probably damaging	1.00
R4953:Pde6a	UTSW	18	61231362	nonsense	probably null
R5323:Pde6a	UTSW	18	61232911	missense	possibly damaging	0.81
R5496:Pde6a	UTSW	18	61253665	critical splice acceptor site	probably null
R5540:Pde6a	UTSW	18	61231366	missense	probably damaging	0.99
R6180:Pde6a	UTSW	18	61284092	splice site	probably null
R6366:Pde6a	UTSW	18	61265071	splice site	probably null
R6743:Pde6a	UTSW	18	61263986	missense	possibly damaging	0.48
R7161:Pde6a	UTSW	18	61281525	missense	probably benign	0.05
R7186:Pde6a	UTSW	18	61220606	start codon destroyed	probably null	0.95
R7197:Pde6a	UTSW	18	61258224	missense	probably damaging	0.96
R7296:Pde6a	UTSW	18	61258293	missense	probably damaging	0.99
R7487:Pde6a	UTSW	18	61249960	missense	probably damaging	1.00
R7734:Pde6a	UTSW	18	61232866	missense	probably benign	0.10
R7818:Pde6a	UTSW	18	61281509	splice site	probably null
R8104:Pde6a	UTSW	18	61231494	missense	probably damaging	0.99
R8135:Pde6a	UTSW	18	61285925	missense	probably damaging	0.98
R8213:Pde6a	UTSW	18	61220696	missense	possibly damaging	0.94
R8266:Pde6a	UTSW	18	61258213	missense	probably damaging	1.00
R8429:Pde6a	UTSW	18	61232844	missense	probably damaging	0.98
R8805:Pde6a	UTSW	18	61257033	missense	probably benign	0.13
R8882:Pde6a	UTSW	18	61245548	missense
R9002:Pde6a	UTSW	18	61285989	missense	probably damaging	1.00
R9015:Pde6a	UTSW	18	61263976	missense	probably damaging	0.99
R9338:Pde6a	UTSW	18	61221037	missense	probably damaging	1.00
R9353:Pde6a	UTSW	18	61257311	missense	probably damaging	1.00
R9446:Pde6a	UTSW	18	61285996	missense	probably benign	0.00
R9458:Pde6a	UTSW	18	61254406	missense	probably damaging	1.00
RF018:Pde6a	UTSW	18	61231403	missense	possibly damaging	0.84
X0064:Pde6a	UTSW	18	61264948	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- AGGAGAGTGAGATCATCTTTGAC -3'
(R):5'- ATGACTAGCCCAGGTTTGGTG -3'

Sequencing Primer
(F):5'- GAGATCATCTTTGACCTCCTGCG -3'
(R):5'- TTTGGTGGCCAGCAACAG -3'

Posted On

2021-01-18