Incidental Mutation 'R8472:Smc3'
ID 657107
Institutional Source Beutler Lab
Gene Symbol Smc3
Ensembl Gene ENSMUSG00000024974
Gene Name structural maintenance of chromosomes 3
Synonyms Cspg6, Bamacan, Mmip1, SmcD
MMRRC Submission 067916-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8472 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 53588827-53634262 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 53617142 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 518 (H518Q)
Ref Sequence ENSEMBL: ENSMUSP00000025930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025930]
AlphaFold Q9CW03
PDB Structure SMC hinge heterodimer (Mouse) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025930
AA Change: H518Q

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000025930
Gene: ENSMUSG00000024974
AA Change: H518Q

DomainStartEndE-ValueType
Pfam:AAA_23 5 359 5.4e-10 PFAM
SMC_hinge 530 643 1.85e-23 SMART
low complexity region 684 711 N/A INTRINSIC
Blast:SMC_hinge 712 804 3e-49 BLAST
low complexity region 805 818 N/A INTRINSIC
Blast:SMC_hinge 819 870 3e-23 BLAST
Blast:INB 898 1174 2e-52 BLAST
PDB:1XEW|Y 1032 1212 6e-30 PDB
SCOP:d1e69a_ 1114 1193 2e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the SMC3 subfamily of SMC proteins. The encoded protein occurs in certain cell types as either an intracellular, nuclear protein or a secreted protein. The nuclear form, known as structural maintenance of chromosomes 3, is a component of the multimeric cohesin complex that holds together sister chromatids during mitosis, enabling proper chromosome segregation. Post-translational modification of the encoded protein by the addition of chondroitin sulfate chains gives rise to the secreted proteoglycan bamacan, an abundant basement membrane protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality. Mice heterozygous for this allele exhibit partial postnatal lethality, decreased body weight, abnormal craniofacial morphology, and increased T cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T A 7: 12,246,568 (GRCm39) H21Q possibly damaging Het
Ccdc7a A G 8: 129,754,138 (GRCm39) S152P probably damaging Het
Ccnj T C 19: 40,833,608 (GRCm39) S222P probably damaging Het
Cdcp2 C T 4: 106,959,981 (GRCm39) A132V probably damaging Het
Cnksr3 G T 10: 7,084,532 (GRCm39) P71Q probably damaging Het
Col9a3 C T 2: 180,247,057 (GRCm39) P185L probably damaging Het
Cpm T C 10: 117,515,883 (GRCm39) V319A probably damaging Het
Ctxn2 A G 2: 124,989,528 (GRCm39) I52V possibly damaging Het
Cyp2c66 A T 19: 39,165,021 (GRCm39) H334L probably benign Het
Dab1 A G 4: 104,336,439 (GRCm39) K12E possibly damaging Het
Efcab3 A T 11: 104,709,463 (GRCm39) D1815V probably benign Het
Emsy T C 7: 98,304,037 (GRCm39) probably benign Het
Etv4 G T 11: 101,674,827 (GRCm39) D56E probably damaging Het
Exoc3l2 C T 7: 19,215,190 (GRCm39) R484* probably null Het
Extl1 A G 4: 134,098,603 (GRCm39) C143R probably benign Het
Fat3 T C 9: 16,286,563 (GRCm39) I987V possibly damaging Het
Fbn1 A C 2: 125,151,722 (GRCm39) C2511G probably damaging Het
Fer T A 17: 64,280,144 (GRCm39) S72T probably benign Het
Gdf2 A G 14: 33,666,797 (GRCm39) D173G probably damaging Het
Grhl3 T C 4: 135,284,176 (GRCm39) E222G probably benign Het
Gria1 A T 11: 57,218,410 (GRCm39) M819L probably benign Het
Gsap A T 5: 21,427,432 (GRCm39) R187* probably null Het
Heatr6 A G 11: 83,656,679 (GRCm39) N314D probably benign Het
Hspd1 T C 1: 55,117,505 (GRCm39) D555G probably benign Het
Ighv3-4 T C 12: 114,217,649 (GRCm39) Y8C probably benign Het
Lcmt2 A G 2: 120,970,729 (GRCm39) V118A probably damaging Het
Lmf2 T C 15: 89,239,005 (GRCm39) E37G possibly damaging Het
Macf1 A G 4: 123,346,795 (GRCm39) L1161P probably damaging Het
Mbip T A 12: 56,377,054 (GRCm39) probably null Het
Mgam A T 6: 40,671,460 (GRCm39) probably null Het
Mmrn1 G A 6: 60,965,380 (GRCm39) S1136N probably damaging Het
Mms22l T C 4: 24,502,943 (GRCm39) V73A possibly damaging Het
Mtbp C T 15: 55,449,748 (GRCm39) L24F probably damaging Het
Ncr1 T A 7: 4,341,120 (GRCm39) I37N probably benign Het
Nkx3-1 A G 14: 69,429,507 (GRCm39) N175S probably damaging Het
Nlrp4f A G 13: 65,342,145 (GRCm39) I500T possibly damaging Het
Or10a3 T A 7: 108,479,973 (GRCm39) Q280L possibly damaging Het
Or1e1f C T 11: 73,856,223 (GRCm39) S263L possibly damaging Het
Or6c33 A G 10: 129,853,445 (GRCm39) T72A probably damaging Het
Pcdha2 A G 18: 37,074,325 (GRCm39) D652G probably damaging Het
Pde6a T A 18: 61,354,018 (GRCm39) N114K probably damaging Het
Pdp2 A G 8: 105,320,913 (GRCm39) E254G probably benign Het
Pip5kl1 T C 2: 32,470,018 (GRCm39) V241A probably benign Het
Prkdc T A 16: 15,469,400 (GRCm39) D168E probably damaging Het
Psg27 A T 7: 18,296,015 (GRCm39) H143Q probably benign Het
Serpina16 T A 12: 103,638,796 (GRCm39) I264F probably benign Het
Slc25a41 G A 17: 57,348,582 (GRCm39) H4Y probably benign Het
Slco1a8 T G 6: 141,949,115 (GRCm39) H87P probably damaging Het
Snrpb G T 2: 130,015,042 (GRCm39) T158K probably damaging Het
Sobp A G 10: 42,898,392 (GRCm39) F398L probably damaging Het
Spidr T A 16: 15,958,591 (GRCm39) Q57L probably benign Het
Srd5a3 T G 5: 76,297,648 (GRCm39) V26G possibly damaging Het
Stx17 A G 4: 48,166,972 (GRCm39) T131A probably benign Het
Susd1 A G 4: 59,332,985 (GRCm39) L553P possibly damaging Het
Tbc1d30 C A 10: 121,187,009 (GRCm39) G59C probably benign Het
Tekt1 T C 11: 72,242,850 (GRCm39) D219G possibly damaging Het
Trav9d-1 A T 14: 53,030,163 (GRCm39) D89V possibly damaging Het
Trim34b T C 7: 103,980,545 (GRCm39) I211T probably benign Het
Vmn1r25 A T 6: 57,955,531 (GRCm39) L253M possibly damaging Het
Vmn1r56 C T 7: 5,198,904 (GRCm39) V238M probably damaging Het
Wipf3 A G 6: 54,466,070 (GRCm39) I443V probably benign Het
Other mutations in Smc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Smc3 APN 19 53,617,758 (GRCm39) missense probably damaging 0.99
IGL01300:Smc3 APN 19 53,630,283 (GRCm39) splice site probably benign
IGL02136:Smc3 APN 19 53,624,147 (GRCm39) missense probably benign 0.02
IGL02216:Smc3 APN 19 53,610,275 (GRCm39) missense probably damaging 1.00
IGL02473:Smc3 APN 19 53,624,879 (GRCm39) missense probably benign 0.06
IGL02797:Smc3 APN 19 53,627,189 (GRCm39) missense probably benign 0.03
IGL02959:Smc3 APN 19 53,611,988 (GRCm39) missense probably benign 0.00
IGL03343:Smc3 APN 19 53,602,273 (GRCm39) missense probably damaging 1.00
Bits UTSW 19 53,611,649 (GRCm39) critical splice donor site probably null
Pieces UTSW 19 53,617,802 (GRCm39) missense probably damaging 0.99
Smithereens UTSW 19 53,630,362 (GRCm39) missense probably damaging 1.00
R0081:Smc3 UTSW 19 53,589,993 (GRCm39) splice site probably benign
R0940:Smc3 UTSW 19 53,629,340 (GRCm39) missense probably benign 0.10
R1248:Smc3 UTSW 19 53,622,509 (GRCm39) missense probably benign 0.01
R1661:Smc3 UTSW 19 53,613,496 (GRCm39) missense probably benign 0.08
R1779:Smc3 UTSW 19 53,627,800 (GRCm39) missense probably benign 0.02
R2046:Smc3 UTSW 19 53,627,845 (GRCm39) missense probably benign 0.00
R2073:Smc3 UTSW 19 53,619,964 (GRCm39) missense probably benign 0.08
R2074:Smc3 UTSW 19 53,619,964 (GRCm39) missense probably benign 0.08
R3077:Smc3 UTSW 19 53,616,322 (GRCm39) missense probably benign 0.16
R4962:Smc3 UTSW 19 53,619,948 (GRCm39) missense probably damaging 0.99
R5684:Smc3 UTSW 19 53,629,235 (GRCm39) missense probably benign 0.00
R6020:Smc3 UTSW 19 53,613,594 (GRCm39) critical splice donor site probably null
R6169:Smc3 UTSW 19 53,622,517 (GRCm39) missense probably benign 0.02
R6221:Smc3 UTSW 19 53,630,362 (GRCm39) missense probably damaging 1.00
R6258:Smc3 UTSW 19 53,616,162 (GRCm39) splice site probably null
R6960:Smc3 UTSW 19 53,617,802 (GRCm39) missense probably damaging 0.99
R7048:Smc3 UTSW 19 53,617,682 (GRCm39) missense probably benign 0.01
R7148:Smc3 UTSW 19 53,630,326 (GRCm39) missense possibly damaging 0.93
R7157:Smc3 UTSW 19 53,630,329 (GRCm39) missense probably damaging 1.00
R7805:Smc3 UTSW 19 53,629,390 (GRCm39) missense probably benign 0.26
R7968:Smc3 UTSW 19 53,611,649 (GRCm39) critical splice donor site probably null
R8066:Smc3 UTSW 19 53,603,576 (GRCm39) missense probably damaging 1.00
R8202:Smc3 UTSW 19 53,617,123 (GRCm39) missense possibly damaging 0.94
R8683:Smc3 UTSW 19 53,629,616 (GRCm39) missense possibly damaging 0.50
R8827:Smc3 UTSW 19 53,611,085 (GRCm39) missense probably benign 0.01
R9072:Smc3 UTSW 19 53,617,200 (GRCm39) missense probably benign 0.00
R9073:Smc3 UTSW 19 53,617,200 (GRCm39) missense probably benign 0.00
R9355:Smc3 UTSW 19 53,622,544 (GRCm39) critical splice donor site probably null
R9428:Smc3 UTSW 19 53,617,150 (GRCm39) missense possibly damaging 0.48
X0026:Smc3 UTSW 19 53,613,551 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GAACCCACAGTTATGCAAAATGTAG -3'
(R):5'- GAGGGTAATGGAAGACATATTGTTC -3'

Sequencing Primer
(F):5'- CCACAGTTATGCAAAATGTAGTTACC -3'
(R):5'- CAAAACCCATTTAAATGTCAGGC -3'
Posted On 2021-01-18