Incidental Mutation 'R8473:Blnk'
ID 657142
Institutional Source Beutler Lab
Gene Symbol Blnk
Ensembl Gene ENSMUSG00000061132
Gene Name B cell linker
Synonyms BASH, Bca, SLP-65, BCA, BLNK, Ly-57, Ly57
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock # R8473 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 40928927-40994535 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 40952410 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 183 (E183G)
Ref Sequence ENSEMBL: ENSMUSP00000112473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054769] [ENSMUST00000117695]
AlphaFold Q9QUN3
Predicted Effect possibly damaging
Transcript: ENSMUST00000054769
AA Change: E183G

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000057844
Gene: ENSMUSG00000061132
AA Change: E183G

DomainStartEndE-ValueType
Blast:SH2 139 180 6e-8 BLAST
low complexity region 235 247 N/A INTRINSIC
low complexity region 251 266 N/A INTRINSIC
SH2 345 436 3.07e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117695
AA Change: E183G

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112473
Gene: ENSMUSG00000061132
AA Change: E183G

DomainStartEndE-ValueType
Blast:SH2 139 180 6e-8 BLAST
low complexity region 235 247 N/A INTRINSIC
low complexity region 251 266 N/A INTRINSIC
SH2 342 433 3.07e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic linker or adaptor protein that plays a critical role in B cell development. This protein bridges B cell receptor-associated kinase activation with downstream signaling pathways, thereby affecting various biological functions. The phosphorylation of five tyrosine residues is necessary for this protein to nucleate distinct signaling effectors following B cell receptor activation. Mutations in this gene cause hypoglobulinemia and absent B cells, a disease in which the pro- to pre-B-cell transition is developmentally blocked. Deficiency in this protein has also been shown in some cases of pre-B acute lymphoblastic leukemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a partial block in pre-B cell development, a lack of B1 B cells, reduced numbers of mature B cells, lower IgM and IgG3 serum levels, poor IgM immune responses, and a high incidence of pre-B cell lymphoma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930583I09Rik T C 17: 64,834,518 D30G unknown Het
Acad12 T C 5: 121,607,475 D251G probably damaging Het
Adamts15 T A 9: 30,904,789 T625S probably damaging Het
Atg13 A T 2: 91,688,648 L151M probably damaging Het
Atp5a1 T C 18: 77,779,925 F250L probably damaging Het
Csf3 T C 11: 98,702,102 L97P probably damaging Het
Derl2 A G 11: 71,019,209 Y10H probably damaging Het
Dgkb A G 12: 38,184,940 N435D probably damaging Het
Dpy19l2 C A 9: 24,581,230 V691L probably benign Het
Exoc5 T C 14: 49,019,403 S509G probably null Het
Fancg A G 4: 43,004,963 I410T probably damaging Het
Fsip2 G A 2: 82,946,992 G121D probably damaging Het
Gfm1 T C 3: 67,453,718 S458P possibly damaging Het
Gm6882 A T 7: 21,427,515 Y143N probably damaging Het
Gm884 T C 11: 103,543,440 T792A unknown Het
Grm5 T A 7: 87,603,070 M176K probably damaging Het
Herc6 T A 6: 57,647,114 V623D probably damaging Het
Hmcn1 G T 1: 150,603,800 P4638T possibly damaging Het
Il27ra A G 8: 84,042,106 Y62H probably benign Het
Kcnh8 A T 17: 52,978,292 S1097C probably benign Het
Kif19a T G 11: 114,787,551 S677A probably damaging Het
Olfr985 T C 9: 40,127,210 I250M probably benign Het
Pcdhgb7 T A 18: 37,753,799 V674D probably benign Het
Pik3r6 A G 11: 68,526,381 S50G probably benign Het
Ptpn12 T C 5: 20,998,359 T474A probably benign Het
Rbbp6 T C 7: 123,001,198 probably benign Het
Scaper T C 9: 55,550,847 Y880C probably damaging Het
Smc5 A T 19: 23,244,082 V361D probably benign Het
Stag1 T A 9: 100,880,787 H480Q probably damaging Het
Tdpoz2 T C 3: 93,651,846 E273G probably damaging Het
Tdpoz3 T A 3: 93,826,563 W182R possibly damaging Het
Tmx4 T C 2: 134,609,524 T170A probably benign Het
Vmn1r59 A T 7: 5,454,065 M232K possibly damaging Het
Wdr20rt A G 12: 65,226,606 D180G probably damaging Het
Other mutations in Blnk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Blnk APN 19 40934446 missense probably benign 0.15
IGL01286:Blnk APN 19 40934506 missense probably benign 0.00
IGL02090:Blnk APN 19 40934485 missense probably benign 0.38
IGL02814:Blnk APN 19 40962429 missense probably damaging 1.00
IGL02831:Blnk APN 19 40962429 missense probably damaging 1.00
IGL03024:Blnk APN 19 40994002 splice site probably benign
Augen UTSW 19 40929291 missense probably damaging 1.00
Blick UTSW 19 40934459 missense probably damaging 1.00
busy UTSW 19 40952391 nonsense probably null
There UTSW 19 40952390 missense possibly damaging 0.94
IGL02988:Blnk UTSW 19 40929216 missense probably damaging 1.00
R0140:Blnk UTSW 19 40940224 missense probably damaging 0.99
R0671:Blnk UTSW 19 40937667 nonsense probably null
R1617:Blnk UTSW 19 40962363 missense probably benign
R1638:Blnk UTSW 19 40937678 missense probably benign
R1803:Blnk UTSW 19 40952377 missense probably damaging 0.96
R1970:Blnk UTSW 19 40940165 splice site probably benign
R2880:Blnk UTSW 19 40962455 missense probably damaging 1.00
R2980:Blnk UTSW 19 40962350 missense probably damaging 1.00
R5421:Blnk UTSW 19 40968523 missense probably damaging 1.00
R5987:Blnk UTSW 19 40929289 missense possibly damaging 0.95
R6321:Blnk UTSW 19 40934459 missense probably damaging 1.00
R6703:Blnk UTSW 19 40962506 splice site probably null
R6970:Blnk UTSW 19 40962377 missense probably damaging 0.99
R7101:Blnk UTSW 19 40972638 missense probably benign 0.01
R7432:Blnk UTSW 19 40959857 nonsense probably null
R7560:Blnk UTSW 19 40952390 missense possibly damaging 0.94
R7797:Blnk UTSW 19 40959788 missense possibly damaging 0.51
R8287:Blnk UTSW 19 40929291 missense probably damaging 1.00
R8798:Blnk UTSW 19 40962351 missense probably damaging 1.00
R9094:Blnk UTSW 19 40994039 missense probably benign 0.39
R9139:Blnk UTSW 19 40934518 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCCAGTGCTTTTATAACCTGG -3'
(R):5'- GTGCCAAAAGGTACCCCATTG -3'

Sequencing Primer
(F):5'- AGGTGCTTCCCTAGTCGAG -3'
(R):5'- CCCCATTGTAAGCAATTTTACAGTG -3'
Posted On 2021-01-18