Mutagenetix > Incidental Mutations

Incidental Mutation 'R8473:Blnk'

657142

Institutional Source

Beutler Lab

Gene Symbol

Blnk

Ensembl Gene

ENSMUSG00000061132

Gene Name

B cell linker

Synonyms

BASH, Bca, SLP-65, BCA, BLNK, Ly-57, Ly57

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.142) question?

Stock #

R8473 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

40928927-40994535 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 40952410 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 183 (E183G)

Ref Sequence

ENSEMBL: ENSMUSP00000112473 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054769] [ENSMUST00000117695]

AlphaFold

Q9QUN3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000054769
AA Change: E183G

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000057844
Gene: ENSMUSG00000061132
AA Change: E183G

Domain	Start	End	E-Value	Type
Blast:SH2	139	180	6e-8	BLAST
low complexity region	235	247	N/A	INTRINSIC
low complexity region	251	266	N/A	INTRINSIC
SH2	345	436	3.07e-19	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117695
AA Change: E183G

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000112473
Gene: ENSMUSG00000061132
AA Change: E183G

Domain	Start	End	E-Value	Type
Blast:SH2	139	180	6e-8	BLAST
low complexity region	235	247	N/A	INTRINSIC
low complexity region	251	266	N/A	INTRINSIC
SH2	342	433	3.07e-19	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic linker or adaptor protein that plays a critical role in B cell development. This protein bridges B cell receptor-associated kinase activation with downstream signaling pathways, thereby affecting various biological functions. The phosphorylation of five tyrosine residues is necessary for this protein to nucleate distinct signaling effectors following B cell receptor activation. Mutations in this gene cause hypoglobulinemia and absent B cells, a disease in which the pro- to pre-B-cell transition is developmentally blocked. Deficiency in this protein has also been shown in some cases of pre-B acute lymphoblastic leukemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a partial block in pre-B cell development, a lack of B1 B cells, reduced numbers of mature B cells, lower IgM and IgG3 serum levels, poor IgM immune responses, and a high incidence of pre-B cell lymphoma. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930583I09Rik	T	C	17: 64,834,518	D30G	unknown	Het
Acad12	T	C	5: 121,607,475	D251G	probably damaging	Het
Adamts15	T	A	9: 30,904,789	T625S	probably damaging	Het
Atg13	A	T	2: 91,688,648	L151M	probably damaging	Het
Atp5a1	T	C	18: 77,779,925	F250L	probably damaging	Het
Csf3	T	C	11: 98,702,102	L97P	probably damaging	Het
Derl2	A	G	11: 71,019,209	Y10H	probably damaging	Het
Dgkb	A	G	12: 38,184,940	N435D	probably damaging	Het
Dpy19l2	C	A	9: 24,581,230	V691L	probably benign	Het
Exoc5	T	C	14: 49,019,403	S509G	probably null	Het
Fancg	A	G	4: 43,004,963	I410T	probably damaging	Het
Fsip2	G	A	2: 82,946,992	G121D	probably damaging	Het
Gfm1	T	C	3: 67,453,718	S458P	possibly damaging	Het
Gm6882	A	T	7: 21,427,515	Y143N	probably damaging	Het
Gm884	T	C	11: 103,543,440	T792A	unknown	Het
Grm5	T	A	7: 87,603,070	M176K	probably damaging	Het
Herc6	T	A	6: 57,647,114	V623D	probably damaging	Het
Hmcn1	G	T	1: 150,603,800	P4638T	possibly damaging	Het
Il27ra	A	G	8: 84,042,106	Y62H	probably benign	Het
Kcnh8	A	T	17: 52,978,292	S1097C	probably benign	Het
Kif19a	T	G	11: 114,787,551	S677A	probably damaging	Het
Olfr985	T	C	9: 40,127,210	I250M	probably benign	Het
Pcdhgb7	T	A	18: 37,753,799	V674D	probably benign	Het
Pik3r6	A	G	11: 68,526,381	S50G	probably benign	Het
Ptpn12	T	C	5: 20,998,359	T474A	probably benign	Het
Rbbp6	T	C	7: 123,001,198		probably benign	Het
Scaper	T	C	9: 55,550,847	Y880C	probably damaging	Het
Smc5	A	T	19: 23,244,082	V361D	probably benign	Het
Stag1	T	A	9: 100,880,787	H480Q	probably damaging	Het
Tdpoz2	T	C	3: 93,651,846	E273G	probably damaging	Het
Tdpoz3	T	A	3: 93,826,563	W182R	possibly damaging	Het
Tmx4	T	C	2: 134,609,524	T170A	probably benign	Het
Vmn1r59	A	T	7: 5,454,065	M232K	possibly damaging	Het
Wdr20rt	A	G	12: 65,226,606	D180G	probably damaging	Het

Other mutations in Blnk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Blnk	APN	19	40934446	missense	probably benign	0.15
IGL01286:Blnk	APN	19	40934506	missense	probably benign	0.00
IGL02090:Blnk	APN	19	40934485	missense	probably benign	0.38
IGL02814:Blnk	APN	19	40962429	missense	probably damaging	1.00
IGL02831:Blnk	APN	19	40962429	missense	probably damaging	1.00
IGL03024:Blnk	APN	19	40994002	splice site	probably benign
Augen	UTSW	19	40929291	missense	probably damaging	1.00
Blick	UTSW	19	40934459	missense	probably damaging	1.00
busy	UTSW	19	40952391	nonsense	probably null
There	UTSW	19	40952390	missense	possibly damaging	0.94
IGL02988:Blnk	UTSW	19	40929216	missense	probably damaging	1.00
R0140:Blnk	UTSW	19	40940224	missense	probably damaging	0.99
R0671:Blnk	UTSW	19	40937667	nonsense	probably null
R1617:Blnk	UTSW	19	40962363	missense	probably benign
R1638:Blnk	UTSW	19	40937678	missense	probably benign
R1803:Blnk	UTSW	19	40952377	missense	probably damaging	0.96
R1970:Blnk	UTSW	19	40940165	splice site	probably benign
R2880:Blnk	UTSW	19	40962455	missense	probably damaging	1.00
R2980:Blnk	UTSW	19	40962350	missense	probably damaging	1.00
R5421:Blnk	UTSW	19	40968523	missense	probably damaging	1.00
R5987:Blnk	UTSW	19	40929289	missense	possibly damaging	0.95
R6321:Blnk	UTSW	19	40934459	missense	probably damaging	1.00
R6703:Blnk	UTSW	19	40962506	splice site	probably null
R6970:Blnk	UTSW	19	40962377	missense	probably damaging	0.99
R7101:Blnk	UTSW	19	40972638	missense	probably benign	0.01
R7432:Blnk	UTSW	19	40959857	nonsense	probably null
R7560:Blnk	UTSW	19	40952390	missense	possibly damaging	0.94
R7797:Blnk	UTSW	19	40959788	missense	possibly damaging	0.51
R8287:Blnk	UTSW	19	40929291	missense	probably damaging	1.00
R8798:Blnk	UTSW	19	40962351	missense	probably damaging	1.00
R9094:Blnk	UTSW	19	40994039	missense	probably benign	0.39
R9139:Blnk	UTSW	19	40934518	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCCCAGTGCTTTTATAACCTGG -3'
(R):5'- GTGCCAAAAGGTACCCCATTG -3'

Sequencing Primer
(F):5'- AGGTGCTTCCCTAGTCGAG -3'
(R):5'- CCCCATTGTAAGCAATTTTACAGTG -3'

Posted On

2021-01-18