Mutagenetix > Incidental Mutation

Incidental Mutation 'R8474:Spag17'

657152

Institutional Source

Beutler Lab

Gene Symbol

Spag17

Ensembl Gene

ENSMUSG00000027867

Gene Name

sperm associated antigen 17

Synonyms

PF6, 4931427F14Rik

MMRRC Submission

067918-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8474 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

99792722-100050638 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 99934586 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 623 (T623S)

Ref Sequence

ENSEMBL: ENSMUSP00000134066 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164539]

AlphaFold

Q5S003

Predicted Effect

probably benign
Transcript: ENSMUST00000164539
AA Change: T623S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000134066
Gene: ENSMUSG00000027867
AA Change: T623S

Domain	Start	End	E-Value	Type
low complexity region	155	170	N/A	INTRINSIC
low complexity region	384	400	N/A	INTRINSIC
low complexity region	876	887	N/A	INTRINSIC
coiled coil region	909	964	N/A	INTRINSIC
coiled coil region	1079	1120	N/A	INTRINSIC
low complexity region	1179	1190	N/A	INTRINSIC
low complexity region	1192	1205	N/A	INTRINSIC
low complexity region	1209	1220	N/A	INTRINSIC
low complexity region	1223	1238	N/A	INTRINSIC
low complexity region	1394	1405	N/A	INTRINSIC
low complexity region	1931	1942	N/A	INTRINSIC
Pfam:PapD-like	2171	2277	1.2e-15	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central pair protein present in the axonemes of cells with a "9 + 2" organization of microtubules. The encoded protein is required for the proper function of the axoneme. Mutations in the orthologous gene in mice lead to primary ciliary dyskinesia characterized by immotile nasal and tracheal cilia, reduced clearance of nasal mucus, profound respiratory distress, hydrocephalus, and neonatal lethality within twelve hours of birth due to impaired airway mucociliary clearance. Single-nucleotide polymorphisms in this gene are associated with human height and targeted mutations lead to skeletal malformations affecting the limbs in mice, suggesting a role for this gene in skeletal development. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous null mice exhibit immotile respiratory cilia with axoneme structural defects, impaired mucociliary clearance, respiratory distress, pulmonary edema, disrupted alveolar epithelium, enlarged brain ventricles consistent with evolving hydrocephalus, failure to suckle, and neonatal lethality. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy8	A	T	15: 64,576,638 (GRCm39)	S975T	probably damaging	Het
Adgrg1	C	G	8: 95,729,936 (GRCm39)	T46S	probably damaging	Het
Akip1	T	A	7: 109,306,697 (GRCm39)	D131E	probably benign	Het
Arhgef39	A	G	4: 43,498,015 (GRCm39)	V163A	probably benign	Het
Atg2a	T	C	19: 6,301,433 (GRCm39)		probably null	Het
Bcam	A	T	7: 19,494,325 (GRCm39)	L357*	probably null	Het
Bcat2	A	G	7: 45,237,075 (GRCm39)	N194S	probably damaging	Het
Bcl2l14	T	C	6: 134,400,720 (GRCm39)	L47P	probably benign	Het
Cbln1	C	T	8: 88,198,673 (GRCm39)	A66T	possibly damaging	Het
Ccdc191	G	T	16: 43,710,262 (GRCm39)		probably benign	Het
Cd70	C	T	17: 57,456,468 (GRCm39)	S45N	possibly damaging	Het
Cfap43	G	A	19: 47,886,363 (GRCm39)	A84V	probably benign	Het
Clca3a1	T	A	3: 144,710,792 (GRCm39)	N804Y	possibly damaging	Het
Cmah	A	T	13: 24,601,350 (GRCm39)	N52I	probably damaging	Het
Crot	A	G	5: 9,043,518 (GRCm39)	Y35H	probably damaging	Het
Cyp3a59	C	A	5: 146,041,487 (GRCm39)	P344T	probably benign	Het
Dnah5	A	G	15: 28,247,978 (GRCm39)	E705G	probably benign	Het
Dnm2	A	G	9: 21,377,016 (GRCm39)	Y125C	probably damaging	Het
Dst	A	G	1: 34,208,266 (GRCm39)	Y739C	probably damaging	Het
Eif3a	A	T	19: 60,767,929 (GRCm39)	M203K	possibly damaging	Het
Enpep	C	T	3: 129,113,076 (GRCm39)	V283M	probably damaging	Het
Ephx3	A	G	17: 32,407,219 (GRCm39)	S240P	probably damaging	Het
Evi5l	T	C	8: 4,260,784 (GRCm39)	H1011R	possibly damaging	Het
Fig4	A	T	10: 41,108,170 (GRCm39)	F677I	probably benign	Het
Gramd1b	A	G	9: 40,287,207 (GRCm39)		probably null	Het
Gse1	C	T	8: 121,295,123 (GRCm39)		probably benign	Het
Hoxa9	A	G	6: 52,202,506 (GRCm39)		probably null	Het
Ice1	A	T	13: 70,752,566 (GRCm39)	S1173R	probably benign	Het
Ifi207	G	A	1: 173,556,605 (GRCm39)	T718I	possibly damaging	Het
Ifit1bl1	A	G	19: 34,572,262 (GRCm39)	L65P	probably damaging	Het
Impact	T	C	18: 13,107,798 (GRCm39)	I22T	probably damaging	Het
Lrp1	A	G	10: 127,375,572 (GRCm39)	C4409R	probably damaging	Het
Mark1	A	G	1: 184,651,783 (GRCm39)	W131R	probably damaging	Het
Mindy3	T	C	2: 12,404,839 (GRCm39)	T190A	probably damaging	Het
Mybbp1a	A	G	11: 72,338,563 (GRCm39)	D721G	probably benign	Het
Myo1d	A	G	11: 80,561,745 (GRCm39)	V466A	possibly damaging	Het
Myo5b	A	C	18: 74,903,411 (GRCm39)	D1809A	probably damaging	Het
Nudcd2	C	T	11: 40,624,850 (GRCm39)	Q20*	probably null	Het
Or4f62	T	C	2: 111,986,320 (GRCm39)	M8T	probably benign	Het
Or5b101	A	G	19: 13,005,357 (GRCm39)	L112P	probably damaging	Het
Or8g2b	T	A	9: 39,751,048 (GRCm39)	L106H	possibly damaging	Het
Pcif1	A	T	2: 164,730,272 (GRCm39)	D335V	probably damaging	Het
Pebp4	T	A	14: 70,085,136 (GRCm39)	C65S	possibly damaging	Het
Ptger1	C	T	8: 84,395,267 (GRCm39)	A248V	probably benign	Het
Qki	A	T	17: 10,537,747 (GRCm39)	M19K	probably benign	Het
Ralgapa2	C	G	2: 146,266,750 (GRCm39)	A609P	probably damaging	Het
Robo2	C	T	16: 73,745,150 (GRCm39)	G875D	probably damaging	Het
Runx2	A	G	17: 44,919,147 (GRCm39)	V375A	probably damaging	Het
Sis	A	T	3: 72,836,730 (GRCm39)	F841I	probably damaging	Het
Slc5a8	A	G	10: 88,757,552 (GRCm39)	D514G	possibly damaging	Het
Sppl2c	A	G	11: 104,078,963 (GRCm39)	S588G	probably benign	Het
Stxbp6	A	C	12: 44,949,704 (GRCm39)	V75G	possibly damaging	Het
Tmc3	G	A	7: 83,259,122 (GRCm39)	R531Q	probably damaging	Het
Tmem258	T	C	19: 10,184,550 (GRCm39)	Y41H	probably damaging	Het
Tsks	A	T	7: 44,600,263 (GRCm39)	T91S	probably damaging	Het
Vmn2r23	T	C	6: 123,681,599 (GRCm39)	V169A	probably benign	Het
Wdr54	T	C	6: 83,129,985 (GRCm39)	N282S	probably benign	Het
Yme1l1	T	A	2: 23,052,584 (GRCm39)	N79K	probably benign	Het

Other mutations in Spag17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01096:Spag17	APN	3	99,970,691 (GRCm39)	missense	probably benign	0.00
IGL01143:Spag17	APN	3	99,846,614 (GRCm39)	missense	probably benign	0.00
IGL01329:Spag17	APN	3	100,002,865 (GRCm39)	missense	probably benign	0.16
IGL01393:Spag17	APN	3	99,934,926 (GRCm39)	missense	possibly damaging	0.53
IGL01617:Spag17	APN	3	100,016,824 (GRCm39)	missense	possibly damaging	0.65
IGL01705:Spag17	APN	3	99,930,046 (GRCm39)	missense	probably benign	0.01
IGL01928:Spag17	APN	3	99,847,390 (GRCm39)	splice site	probably benign
IGL01981:Spag17	APN	3	99,966,149 (GRCm39)	missense	probably benign	0.03
IGL02435:Spag17	APN	3	99,889,760 (GRCm39)	missense	possibly damaging	0.53
IGL02452:Spag17	APN	3	99,934,707 (GRCm39)	missense	probably benign	0.00
IGL02465:Spag17	APN	3	99,983,187 (GRCm39)	missense	probably damaging	0.96
IGL02615:Spag17	APN	3	99,979,401 (GRCm39)	missense	probably benign	0.09
IGL02751:Spag17	APN	3	99,918,110 (GRCm39)	nonsense	probably null
IGL02803:Spag17	APN	3	100,016,713 (GRCm39)	missense	probably benign
IGL02898:Spag17	APN	3	100,008,702 (GRCm39)	missense	probably benign	0.00
IGL03037:Spag17	APN	3	99,979,486 (GRCm39)	splice site	probably null
IGL03068:Spag17	APN	3	99,987,521 (GRCm39)	missense	probably benign	0.35
IGL03131:Spag17	APN	3	99,918,075 (GRCm39)	missense	possibly damaging	0.85
IGL03224:Spag17	APN	3	99,918,156 (GRCm39)	missense	possibly damaging	0.53
FR4342:Spag17	UTSW	3	99,963,568 (GRCm39)	small insertion	probably benign
FR4342:Spag17	UTSW	3	99,963,565 (GRCm39)	small insertion	probably benign
FR4548:Spag17	UTSW	3	99,963,570 (GRCm39)	small insertion	probably benign
FR4589:Spag17	UTSW	3	99,963,574 (GRCm39)	small insertion	probably benign
FR4589:Spag17	UTSW	3	99,963,561 (GRCm39)	small insertion	probably benign
FR4737:Spag17	UTSW	3	99,963,573 (GRCm39)	small insertion	probably benign
FR4976:Spag17	UTSW	3	99,963,571 (GRCm39)	small insertion	probably benign
FR4976:Spag17	UTSW	3	99,963,570 (GRCm39)	small insertion	probably benign
N/A:Spag17	UTSW	3	99,889,570 (GRCm39)	splice site	probably benign
PIT4504001:Spag17	UTSW	3	100,010,426 (GRCm39)	critical splice acceptor site	probably null
PIT4514001:Spag17	UTSW	3	99,920,527 (GRCm39)	missense	possibly damaging	0.53
R0107:Spag17	UTSW	3	99,958,103 (GRCm39)	missense	possibly damaging	0.72
R0230:Spag17	UTSW	3	100,014,143 (GRCm39)	missense	probably benign	0.08
R0243:Spag17	UTSW	3	99,992,684 (GRCm39)	missense	probably benign	0.04
R0321:Spag17	UTSW	3	100,008,719 (GRCm39)	missense	probably damaging	0.99
R0375:Spag17	UTSW	3	99,934,906 (GRCm39)	missense	probably benign
R0417:Spag17	UTSW	3	99,972,870 (GRCm39)	missense	probably benign	0.11
R0490:Spag17	UTSW	3	99,889,727 (GRCm39)	missense	probably damaging	0.97
R0537:Spag17	UTSW	3	100,032,618 (GRCm39)	missense	probably damaging	0.98
R0714:Spag17	UTSW	3	99,987,472 (GRCm39)	missense	probably damaging	0.97
R0844:Spag17	UTSW	3	99,912,101 (GRCm39)	missense	probably benign
R0919:Spag17	UTSW	3	99,979,259 (GRCm39)	splice site	probably benign
R0926:Spag17	UTSW	3	99,979,432 (GRCm39)	missense	probably benign
R1037:Spag17	UTSW	3	100,010,433 (GRCm39)	missense	probably benign	0.01
R1075:Spag17	UTSW	3	100,000,992 (GRCm39)	missense	probably damaging	0.99
R1109:Spag17	UTSW	3	99,934,667 (GRCm39)	missense	possibly damaging	0.86
R1213:Spag17	UTSW	3	100,002,954 (GRCm39)	missense	probably benign	0.01
R1221:Spag17	UTSW	3	99,889,584 (GRCm39)	missense	possibly damaging	0.72
R1576:Spag17	UTSW	3	99,846,679 (GRCm39)	missense	possibly damaging	0.73
R1586:Spag17	UTSW	3	99,929,068 (GRCm39)	missense	possibly damaging	0.53
R1768:Spag17	UTSW	3	99,934,668 (GRCm39)	missense	possibly damaging	0.53
R1782:Spag17	UTSW	3	99,918,070 (GRCm39)	missense	probably benign	0.02
R1789:Spag17	UTSW	3	99,846,672 (GRCm39)	missense	possibly damaging	0.73
R1945:Spag17	UTSW	3	99,847,298 (GRCm39)	missense	probably benign
R2065:Spag17	UTSW	3	99,920,524 (GRCm39)	missense	probably benign	0.03
R2118:Spag17	UTSW	3	99,956,556 (GRCm39)	missense	possibly damaging	0.72
R2265:Spag17	UTSW	3	99,969,182 (GRCm39)	splice site	probably null
R2266:Spag17	UTSW	3	99,969,182 (GRCm39)	splice site	probably null
R2267:Spag17	UTSW	3	99,969,182 (GRCm39)	splice site	probably null
R2268:Spag17	UTSW	3	99,969,182 (GRCm39)	splice site	probably null
R2271:Spag17	UTSW	3	100,014,113 (GRCm39)	missense	probably damaging	1.00
R2389:Spag17	UTSW	3	100,014,153 (GRCm39)	missense	probably benign	0.27
R2420:Spag17	UTSW	3	99,934,935 (GRCm39)	missense	probably benign
R2422:Spag17	UTSW	3	99,934,935 (GRCm39)	missense	probably benign
R2423:Spag17	UTSW	3	100,010,772 (GRCm39)	missense	probably benign
R3407:Spag17	UTSW	3	99,992,615 (GRCm39)	missense	probably benign	0.09
R3801:Spag17	UTSW	3	99,961,169 (GRCm39)	missense	possibly damaging	0.53
R3856:Spag17	UTSW	3	100,014,075 (GRCm39)	missense	probably damaging	1.00
R4021:Spag17	UTSW	3	99,956,546 (GRCm39)	missense	probably benign	0.00
R4022:Spag17	UTSW	3	99,956,546 (GRCm39)	missense	probably benign	0.00
R4408:Spag17	UTSW	3	100,010,694 (GRCm39)	missense	probably benign
R4468:Spag17	UTSW	3	99,992,682 (GRCm39)	missense	probably damaging	0.98
R4540:Spag17	UTSW	3	99,995,697 (GRCm39)	missense	probably damaging	1.00
R4621:Spag17	UTSW	3	100,010,559 (GRCm39)	missense	probably benign	0.08
R4622:Spag17	UTSW	3	100,010,559 (GRCm39)	missense	probably benign	0.08
R4756:Spag17	UTSW	3	100,010,701 (GRCm39)	missense	possibly damaging	0.68
R4797:Spag17	UTSW	3	99,891,795 (GRCm39)	missense	possibly damaging	0.70
R4855:Spag17	UTSW	3	99,970,649 (GRCm39)	missense	probably benign	0.02
R4887:Spag17	UTSW	3	99,958,147 (GRCm39)	missense	probably damaging	1.00
R4962:Spag17	UTSW	3	99,934,939 (GRCm39)	missense	probably benign
R5030:Spag17	UTSW	3	99,992,657 (GRCm39)	nonsense	probably null
R5042:Spag17	UTSW	3	99,979,465 (GRCm39)	missense	probably damaging	1.00
R5074:Spag17	UTSW	3	99,987,434 (GRCm39)	missense	possibly damaging	0.94
R5195:Spag17	UTSW	3	100,008,704 (GRCm39)	missense	probably benign	0.16
R5200:Spag17	UTSW	3	99,970,787 (GRCm39)	nonsense	probably null
R5267:Spag17	UTSW	3	99,969,264 (GRCm39)	missense	probably damaging	0.98
R5360:Spag17	UTSW	3	100,016,726 (GRCm39)	missense	probably benign	0.00
R5444:Spag17	UTSW	3	99,963,468 (GRCm39)	missense	probably benign	0.06
R5498:Spag17	UTSW	3	100,010,661 (GRCm39)	missense	possibly damaging	0.83
R5503:Spag17	UTSW	3	99,934,560 (GRCm39)	missense	possibly damaging	0.72
R5540:Spag17	UTSW	3	99,963,588 (GRCm39)	missense	possibly damaging	0.91
R5547:Spag17	UTSW	3	99,963,468 (GRCm39)	missense	probably benign	0.06
R5575:Spag17	UTSW	3	99,961,138 (GRCm39)	missense	possibly damaging	0.85
R5629:Spag17	UTSW	3	99,987,435 (GRCm39)	missense	probably benign	0.33
R5639:Spag17	UTSW	3	99,963,482 (GRCm39)	missense	probably damaging	1.00
R5842:Spag17	UTSW	3	99,846,566 (GRCm39)	missense	possibly damaging	0.85
R5976:Spag17	UTSW	3	100,003,107 (GRCm39)	nonsense	probably null
R6082:Spag17	UTSW	3	100,031,501 (GRCm39)	missense	possibly damaging	0.46
R6228:Spag17	UTSW	3	99,929,918 (GRCm39)	missense	probably benign	0.33
R6254:Spag17	UTSW	3	99,972,901 (GRCm39)	missense	probably benign	0.03
R6321:Spag17	UTSW	3	99,995,743 (GRCm39)	missense	probably benign	0.05
R6446:Spag17	UTSW	3	100,010,448 (GRCm39)	missense	probably benign
R6687:Spag17	UTSW	3	100,000,266 (GRCm39)	missense	probably benign	0.07
R6853:Spag17	UTSW	3	99,920,551 (GRCm39)	missense	possibly damaging	0.86
R6946:Spag17	UTSW	3	99,911,999 (GRCm39)	missense	possibly damaging	0.53
R6953:Spag17	UTSW	3	99,942,291 (GRCm39)	missense	possibly damaging	0.53
R7038:Spag17	UTSW	3	99,891,925 (GRCm39)	missense	probably benign	0.00
R7084:Spag17	UTSW	3	99,846,586 (GRCm39)	missense	probably benign	0.18
R7126:Spag17	UTSW	3	100,008,751 (GRCm39)	missense	probably benign	0.00
R7144:Spag17	UTSW	3	99,934,717 (GRCm39)	splice site	probably null
R7198:Spag17	UTSW	3	100,002,888 (GRCm39)	missense	probably benign	0.02
R7318:Spag17	UTSW	3	99,847,299 (GRCm39)	missense	probably benign	0.00
R7403:Spag17	UTSW	3	99,846,691 (GRCm39)	missense	possibly damaging	0.53
R7409:Spag17	UTSW	3	99,941,475 (GRCm39)	missense	probably benign	0.00
R7409:Spag17	UTSW	3	99,934,547 (GRCm39)	missense	possibly damaging	0.73
R7537:Spag17	UTSW	3	99,846,563 (GRCm39)	missense	possibly damaging	0.96
R7609:Spag17	UTSW	3	100,002,911 (GRCm39)	nonsense	probably null
R7772:Spag17	UTSW	3	99,987,434 (GRCm39)	missense	probably damaging	0.98
R7842:Spag17	UTSW	3	99,961,174 (GRCm39)	missense	probably benign	0.18
R7963:Spag17	UTSW	3	99,929,954 (GRCm39)	missense	probably benign	0.02
R8168:Spag17	UTSW	3	99,942,300 (GRCm39)	missense	possibly damaging	0.96
R8291:Spag17	UTSW	3	99,968,166 (GRCm39)	missense	probably benign
R8347:Spag17	UTSW	3	99,934,957 (GRCm39)	missense	probably benign
R8383:Spag17	UTSW	3	99,992,708 (GRCm39)	missense	probably damaging	0.98
R8528:Spag17	UTSW	3	100,031,501 (GRCm39)	missense	possibly damaging	0.46
R8804:Spag17	UTSW	3	99,874,506 (GRCm39)	missense	probably benign
R8809:Spag17	UTSW	3	99,889,738 (GRCm39)	missense	probably benign	0.33
R8818:Spag17	UTSW	3	99,920,543 (GRCm39)	missense	probably benign	0.02
R8830:Spag17	UTSW	3	100,032,751 (GRCm39)	missense	possibly damaging	0.77
R8890:Spag17	UTSW	3	99,911,994 (GRCm39)	missense	possibly damaging	0.73
R9008:Spag17	UTSW	3	99,934,942 (GRCm39)	missense	possibly damaging	0.73
R9095:Spag17	UTSW	3	99,912,092 (GRCm39)	missense	possibly damaging	0.86
R9143:Spag17	UTSW	3	99,934,906 (GRCm39)	missense	probably benign
R9182:Spag17	UTSW	3	99,966,158 (GRCm39)	missense	possibly damaging	0.92
R9211:Spag17	UTSW	3	100,032,614 (GRCm39)	critical splice acceptor site	probably benign
R9344:Spag17	UTSW	3	100,010,793 (GRCm39)	missense	probably benign	0.01
R9354:Spag17	UTSW	3	99,934,905 (GRCm39)	missense	probably benign
R9527:Spag17	UTSW	3	99,970,777 (GRCm39)	missense	probably damaging	1.00
R9658:Spag17	UTSW	3	99,934,932 (GRCm39)	missense	possibly damaging	0.93
R9738:Spag17	UTSW	3	99,934,526 (GRCm39)	missense	possibly damaging	0.53
X0025:Spag17	UTSW	3	100,008,767 (GRCm39)	missense	probably benign	0.31
Z1088:Spag17	UTSW	3	100,002,946 (GRCm39)	missense	probably benign	0.09
Z1176:Spag17	UTSW	3	99,920,309 (GRCm39)	missense	probably benign	0.18
Z1177:Spag17	UTSW	3	99,995,715 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCACCCGTGATGACATGAAC -3'
(R):5'- AAGAGCATCCATTAGTCACAGTG -3'

Sequencing Primer
(F):5'- ATGACATGAACCCTTGGTGC -3'
(R):5'- TCCATTAGTCACAGTGCCAGGATG -3'

Posted On

2021-01-18