Incidental Mutation 'R8474:Vmn2r23'
ID 657160
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Name vomeronasal 2, receptor 23
Synonyms EG435916
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock # R8474 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 123702821-123742291 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 123704640 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 169 (V169A)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
AlphaFold E9PXI5
Predicted Effect probably benign
Transcript: ENSMUST00000172391
AA Change: V169A

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: V169A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A T 15: 64,704,789 S975T probably damaging Het
Adgrg1 C G 8: 95,003,308 T46S probably damaging Het
Akip1 T A 7: 109,707,490 D131E probably benign Het
Arhgef39 A G 4: 43,498,015 V163A probably benign Het
Atg2a T C 19: 6,251,403 probably null Het
Bcam A T 7: 19,760,400 L357* probably null Het
Bcat2 A G 7: 45,587,651 N194S probably damaging Het
Bcl2l14 T C 6: 134,423,757 L47P probably benign Het
Cbln1 C T 8: 87,472,045 A66T possibly damaging Het
Ccdc191 G T 16: 43,889,899 probably benign Het
Cd70 C T 17: 57,149,468 S45N possibly damaging Het
Cfap43 G A 19: 47,897,924 A84V probably benign Het
Clca1 T A 3: 145,005,031 N804Y possibly damaging Het
Cmah A T 13: 24,417,367 N52I probably damaging Het
Crot A G 5: 8,993,518 Y35H probably damaging Het
Cyp3a59 C A 5: 146,104,677 P344T probably benign Het
Dnah5 A G 15: 28,247,832 E705G probably benign Het
Dnm2 A G 9: 21,465,720 Y125C probably damaging Het
Dst A G 1: 34,169,185 Y739C probably damaging Het
Eif3a A T 19: 60,779,491 M203K possibly damaging Het
Enpep C T 3: 129,319,427 V283M probably damaging Het
Ephx3 A G 17: 32,188,245 S240P probably damaging Het
Evi5l T C 8: 4,210,784 H1011R possibly damaging Het
Fig4 A T 10: 41,232,174 F677I probably benign Het
Gramd1b A G 9: 40,375,911 probably null Het
Gse1 C T 8: 120,568,384 probably benign Het
Hoxa9 A G 6: 52,225,526 probably null Het
Ice1 A T 13: 70,604,447 S1173R probably benign Het
Ifi207 G A 1: 173,729,039 T718I possibly damaging Het
Ifit1bl1 A G 19: 34,594,862 L65P probably damaging Het
Impact T C 18: 12,974,741 I22T probably damaging Het
Lrp1 A G 10: 127,539,703 C4409R probably damaging Het
Mark1 A G 1: 184,919,586 W131R probably damaging Het
Mindy3 T C 2: 12,400,028 T190A probably damaging Het
Mybbp1a A G 11: 72,447,737 D721G probably benign Het
Myo1d A G 11: 80,670,919 V466A possibly damaging Het
Myo5b A C 18: 74,770,340 D1809A probably damaging Het
Nudcd2 C T 11: 40,734,023 Q20* probably null Het
Olfr1318 T C 2: 112,155,975 M8T probably benign Het
Olfr1453 A G 19: 13,027,993 L112P probably damaging Het
Olfr971 T A 9: 39,839,752 L106H possibly damaging Het
Pcif1 A T 2: 164,888,352 D335V probably damaging Het
Pebp4 T A 14: 69,847,687 C65S possibly damaging Het
Ptger1 C T 8: 83,668,638 A248V probably benign Het
Qk A T 17: 10,318,818 M19K probably benign Het
Ralgapa2 C G 2: 146,424,830 A609P probably damaging Het
Robo2 C T 16: 73,948,262 G875D probably damaging Het
Runx2 A G 17: 44,608,260 V375A probably damaging Het
Sis A T 3: 72,929,397 F841I probably damaging Het
Slc5a8 A G 10: 88,921,690 D514G possibly damaging Het
Spag17 A T 3: 100,027,270 T623S probably benign Het
Sppl2c A G 11: 104,188,137 S588G probably benign Het
Stxbp6 A C 12: 44,902,921 V75G possibly damaging Het
Tmc3 G A 7: 83,609,914 R531Q probably damaging Het
Tmem258 T C 19: 10,207,186 Y41H probably damaging Het
Tsks A T 7: 44,950,839 T91S probably damaging Het
Wdr54 T C 6: 83,153,004 N282S probably benign Het
Yme1l1 T A 2: 23,162,572 N79K probably benign Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123729725 missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123729596 missense probably benign
IGL01073:Vmn2r23 APN 6 123712800 missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123704424 missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123704407 missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123741886 missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123741860 missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123741744 missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123741836 missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123704478 missense probably benign
IGL02831:Vmn2r23 APN 6 123704385 missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123704396 missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123741619 missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123741782 missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123704374 missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123729626 missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123729721 missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123742135 missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123742004 missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123713270 nonsense probably null
R1629:Vmn2r23 UTSW 6 123713427 missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123729690 missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123702915 missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123713010 missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123741499 missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123704425 missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123742188 nonsense probably null
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123713170 missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123741389 missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123729738 missense probably benign
R4506:Vmn2r23 UTSW 6 123702925 missense probably damaging 1.00
R4652:Vmn2r23 UTSW 6 123741730 missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123741826 missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123733349 missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123713002 missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123733273 missense probably benign
R5761:Vmn2r23 UTSW 6 123712759 missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123733393 missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123712942 missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123741895 missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123704400 missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123712902 missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123713425 missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123733273 missense probably benign
R6925:Vmn2r23 UTSW 6 123704553 missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123713022 missense probably benign
R7215:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123741581 missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123704579 missense probably benign 0.01
R8015:Vmn2r23 UTSW 6 123704541 missense probably benign 0.00
R8143:Vmn2r23 UTSW 6 123741353 missense probably damaging 0.99
R8520:Vmn2r23 UTSW 6 123741656 missense probably damaging 0.99
R8679:Vmn2r23 UTSW 6 123713472 missense probably damaging 0.99
R8713:Vmn2r23 UTSW 6 123703032 missense
R8966:Vmn2r23 UTSW 6 123742120 missense possibly damaging 0.94
R9124:Vmn2r23 UTSW 6 123742079 missense possibly damaging 0.57
R9163:Vmn2r23 UTSW 6 123741823 missense probably damaging 1.00
R9189:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R9451:Vmn2r23 UTSW 6 123733393 missense probably damaging 1.00
R9495:Vmn2r23 UTSW 6 123712713 missense probably benign 0.30
R9514:Vmn2r23 UTSW 6 123712713 missense probably benign 0.30
RF018:Vmn2r23 UTSW 6 123713116 missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123713161 missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123742108 missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123729725 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAATATGACCCTGGGATTCTCTC -3'
(R):5'- GGCAAAGGACATTTTCTTGGG -3'

Sequencing Primer
(F):5'- GGGATTCTCTCTCTTCAATGTTGAC -3'
(R):5'- CATTTTCTTGGGAGTGGTAAGAATAC -3'
Posted On 2021-01-18