Incidental Mutation 'R8474:Vmn2r23'
ID657160
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Namevomeronasal 2, receptor 23
SynonymsEG435916
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R8474 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location123702821-123742291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123704640 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 169 (V169A)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
Predicted Effect probably benign
Transcript: ENSMUST00000172391
AA Change: V169A

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: V169A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A T 15: 64,704,789 S975T probably damaging Het
Adgrg1 C G 8: 95,003,308 T46S probably damaging Het
Akip1 T A 7: 109,707,490 D131E probably benign Het
Arhgef39 A G 4: 43,498,015 V163A probably benign Het
Atg2a T C 19: 6,251,403 probably null Het
Bcam A T 7: 19,760,400 L357* probably null Het
Bcat2 A G 7: 45,587,651 N194S probably damaging Het
Bcl2l14 T C 6: 134,423,757 L47P probably benign Het
Cbln1 C T 8: 87,472,045 A66T possibly damaging Het
Ccdc191 G T 16: 43,889,899 probably benign Het
Cd70 C T 17: 57,149,468 S45N possibly damaging Het
Cfap43 G A 19: 47,897,924 A84V probably benign Het
Clca1 T A 3: 145,005,031 N804Y possibly damaging Het
Cmah A T 13: 24,417,367 N52I probably damaging Het
Crot A G 5: 8,993,518 Y35H probably damaging Het
Cyp3a59 C A 5: 146,104,677 P344T probably benign Het
Dnah5 A G 15: 28,247,832 E705G probably benign Het
Dnm2 A G 9: 21,465,720 Y125C probably damaging Het
Dst A G 1: 34,169,185 Y739C probably damaging Het
Eif3a A T 19: 60,779,491 M203K possibly damaging Het
Enpep C T 3: 129,319,427 V283M probably damaging Het
Ephx3 A G 17: 32,188,245 S240P probably damaging Het
Evi5l T C 8: 4,210,784 H1011R possibly damaging Het
Fig4 A T 10: 41,232,174 F677I probably benign Het
Gramd1b A G 9: 40,375,911 probably null Het
Gse1 C T 8: 120,568,384 probably benign Het
Hoxa9 A G 6: 52,225,526 probably null Het
Ice1 A T 13: 70,604,447 S1173R probably benign Het
Ifi207 G A 1: 173,729,039 T718I possibly damaging Het
Ifit1bl1 A G 19: 34,594,862 L65P probably damaging Het
Impact T C 18: 12,974,741 I22T probably damaging Het
Lrp1 A G 10: 127,539,703 C4409R probably damaging Het
Mark1 A G 1: 184,919,586 W131R probably damaging Het
Mindy3 T C 2: 12,400,028 T190A probably damaging Het
Mybbp1a A G 11: 72,447,737 D721G probably benign Het
Myo1d A G 11: 80,670,919 V466A possibly damaging Het
Myo5b A C 18: 74,770,340 D1809A probably damaging Het
Nudcd2 C T 11: 40,734,023 Q20* probably null Het
Olfr1318 T C 2: 112,155,975 M8T probably benign Het
Olfr1453 A G 19: 13,027,993 L112P probably damaging Het
Olfr971 T A 9: 39,839,752 L106H possibly damaging Het
Pcif1 A T 2: 164,888,352 D335V probably damaging Het
Pebp4 T A 14: 69,847,687 C65S possibly damaging Het
Ptger1 C T 8: 83,668,638 A248V probably benign Het
Qk A T 17: 10,318,818 M19K probably benign Het
Ralgapa2 C G 2: 146,424,830 A609P probably damaging Het
Robo2 C T 16: 73,948,262 G875D probably damaging Het
Runx2 A G 17: 44,608,260 V375A probably damaging Het
Sis A T 3: 72,929,397 F841I probably damaging Het
Slc5a8 A G 10: 88,921,690 D514G possibly damaging Het
Spag17 A T 3: 100,027,270 T623S probably benign Het
Sppl2c A G 11: 104,188,137 S588G probably benign Het
Stxbp6 A C 12: 44,902,921 V75G possibly damaging Het
Tmc3 G A 7: 83,609,914 R531Q probably damaging Het
Tmem258 T C 19: 10,207,186 Y41H probably damaging Het
Tsks A T 7: 44,950,839 T91S probably damaging Het
Wdr54 T C 6: 83,153,004 N282S probably benign Het
Yme1l1 T A 2: 23,162,572 N79K probably benign Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123729725 missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123729596 missense probably benign
IGL01073:Vmn2r23 APN 6 123712800 missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123704424 missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123704407 missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123741886 missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123741860 missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123741744 missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123741836 missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123704478 missense probably benign
IGL02831:Vmn2r23 APN 6 123704385 missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123704396 missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123741619 missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123741782 missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123704374 missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123729626 missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123729721 missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123742135 missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123742004 missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123713270 nonsense probably null
R1629:Vmn2r23 UTSW 6 123713427 missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123729690 missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123702915 missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123713010 missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123741499 missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123704425 missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123742188 nonsense probably null
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123713170 missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123741389 missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123729738 missense probably benign
R4506:Vmn2r23 UTSW 6 123702925 missense probably damaging 1.00
R4652:Vmn2r23 UTSW 6 123741730 missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123741826 missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123733349 missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123713002 missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123733273 missense probably benign
R5761:Vmn2r23 UTSW 6 123712759 missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123733393 missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123712942 missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123741895 missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123704400 missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123712902 missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123713425 missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123733273 missense probably benign
R6925:Vmn2r23 UTSW 6 123704553 missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123713022 missense probably benign
R7215:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123741581 missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123704579 missense probably benign 0.01
R8015:Vmn2r23 UTSW 6 123704541 missense probably benign 0.00
R8143:Vmn2r23 UTSW 6 123741353 missense probably damaging 0.99
R8520:Vmn2r23 UTSW 6 123741656 missense probably damaging 0.99
R8679:Vmn2r23 UTSW 6 123713472 missense probably damaging 0.99
R8713:Vmn2r23 UTSW 6 123703032 missense
R8966:Vmn2r23 UTSW 6 123742120 missense possibly damaging 0.94
RF018:Vmn2r23 UTSW 6 123713116 missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123713161 missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123742108 missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123729725 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAATATGACCCTGGGATTCTCTC -3'
(R):5'- GGCAAAGGACATTTTCTTGGG -3'

Sequencing Primer
(F):5'- GGGATTCTCTCTCTTCAATGTTGAC -3'
(R):5'- CATTTTCTTGGGAGTGGTAAGAATAC -3'
Posted On2021-01-18