Mutagenetix > Incidental Mutations

Incidental Mutation 'R8474:Vmn2r23'

657160

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r23

Ensembl Gene

ENSMUSG00000091620

Gene Name

vomeronasal 2, receptor 23

Synonyms

EG435916

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R8474 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

123702821-123742291 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 123704640 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 169 (V169A)

Ref Sequence

ENSEMBL: ENSMUSP00000126682 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172391]

Predicted Effect

probably benign
Transcript: ENSMUST00000172391
AA Change: V169A

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: V169A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	79	461	1.7e-31	PFAM
Pfam:NCD3G	513	566	1.2e-23	PFAM
Pfam:7tm_3	596	834	1.5e-55	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy8	A	T	15: 64,704,789	S975T	probably damaging	Het
Adgrg1	C	G	8: 95,003,308	T46S	probably damaging	Het
Akip1	T	A	7: 109,707,490	D131E	probably benign	Het
Arhgef39	A	G	4: 43,498,015	V163A	probably benign	Het
Atg2a	T	C	19: 6,251,403		probably null	Het
Bcam	A	T	7: 19,760,400	L357*	probably null	Het
Bcat2	A	G	7: 45,587,651	N194S	probably damaging	Het
Bcl2l14	T	C	6: 134,423,757	L47P	probably benign	Het
Cbln1	C	T	8: 87,472,045	A66T	possibly damaging	Het
Ccdc191	G	T	16: 43,889,899		probably benign	Het
Cd70	C	T	17: 57,149,468	S45N	possibly damaging	Het
Cfap43	G	A	19: 47,897,924	A84V	probably benign	Het
Clca1	T	A	3: 145,005,031	N804Y	possibly damaging	Het
Cmah	A	T	13: 24,417,367	N52I	probably damaging	Het
Crot	A	G	5: 8,993,518	Y35H	probably damaging	Het
Cyp3a59	C	A	5: 146,104,677	P344T	probably benign	Het
Dnah5	A	G	15: 28,247,832	E705G	probably benign	Het
Dnm2	A	G	9: 21,465,720	Y125C	probably damaging	Het
Dst	A	G	1: 34,169,185	Y739C	probably damaging	Het
Eif3a	A	T	19: 60,779,491	M203K	possibly damaging	Het
Enpep	C	T	3: 129,319,427	V283M	probably damaging	Het
Ephx3	A	G	17: 32,188,245	S240P	probably damaging	Het
Evi5l	T	C	8: 4,210,784	H1011R	possibly damaging	Het
Fig4	A	T	10: 41,232,174	F677I	probably benign	Het
Gramd1b	A	G	9: 40,375,911		probably null	Het
Gse1	C	T	8: 120,568,384		probably benign	Het
Hoxa9	A	G	6: 52,225,526		probably null	Het
Ice1	A	T	13: 70,604,447	S1173R	probably benign	Het
Ifi207	G	A	1: 173,729,039	T718I	possibly damaging	Het
Ifit1bl1	A	G	19: 34,594,862	L65P	probably damaging	Het
Impact	T	C	18: 12,974,741	I22T	probably damaging	Het
Lrp1	A	G	10: 127,539,703	C4409R	probably damaging	Het
Mark1	A	G	1: 184,919,586	W131R	probably damaging	Het
Mindy3	T	C	2: 12,400,028	T190A	probably damaging	Het
Mybbp1a	A	G	11: 72,447,737	D721G	probably benign	Het
Myo1d	A	G	11: 80,670,919	V466A	possibly damaging	Het
Myo5b	A	C	18: 74,770,340	D1809A	probably damaging	Het
Nudcd2	C	T	11: 40,734,023	Q20*	probably null	Het
Olfr1318	T	C	2: 112,155,975	M8T	probably benign	Het
Olfr1453	A	G	19: 13,027,993	L112P	probably damaging	Het
Olfr971	T	A	9: 39,839,752	L106H	possibly damaging	Het
Pcif1	A	T	2: 164,888,352	D335V	probably damaging	Het
Pebp4	T	A	14: 69,847,687	C65S	possibly damaging	Het
Ptger1	C	T	8: 83,668,638	A248V	probably benign	Het
Qk	A	T	17: 10,318,818	M19K	probably benign	Het
Ralgapa2	C	G	2: 146,424,830	A609P	probably damaging	Het
Robo2	C	T	16: 73,948,262	G875D	probably damaging	Het
Runx2	A	G	17: 44,608,260	V375A	probably damaging	Het
Sis	A	T	3: 72,929,397	F841I	probably damaging	Het
Slc5a8	A	G	10: 88,921,690	D514G	possibly damaging	Het
Spag17	A	T	3: 100,027,270	T623S	probably benign	Het
Sppl2c	A	G	11: 104,188,137	S588G	probably benign	Het
Stxbp6	A	C	12: 44,902,921	V75G	possibly damaging	Het
Tmc3	G	A	7: 83,609,914	R531Q	probably damaging	Het
Tmem258	T	C	19: 10,207,186	Y41H	probably damaging	Het
Tsks	A	T	7: 44,950,839	T91S	probably damaging	Het
Wdr54	T	C	6: 83,153,004	N282S	probably benign	Het
Yme1l1	T	A	2: 23,162,572	N79K	probably benign	Het

Other mutations in Vmn2r23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Vmn2r23	APN	6	123729725	missense	possibly damaging	0.89
IGL01012:Vmn2r23	APN	6	123729596	missense	probably benign
IGL01073:Vmn2r23	APN	6	123712800	missense	possibly damaging	0.82
IGL01547:Vmn2r23	APN	6	123704424	missense	possibly damaging	0.88
IGL01571:Vmn2r23	APN	6	123704407	missense	probably damaging	1.00
IGL01950:Vmn2r23	APN	6	123741886	missense	possibly damaging	0.80
IGL02028:Vmn2r23	APN	6	123741860	missense	probably damaging	1.00
IGL02248:Vmn2r23	APN	6	123741744	missense	probably damaging	0.96
IGL02318:Vmn2r23	APN	6	123741836	missense	probably benign	0.10
IGL02649:Vmn2r23	APN	6	123704478	missense	probably benign
IGL02831:Vmn2r23	APN	6	123704385	missense	probably benign	0.22
IGL02832:Vmn2r23	APN	6	123704396	missense	probably benign	0.00
IGL02865:Vmn2r23	APN	6	123741619	missense	probably damaging	1.00
IGL02964:Vmn2r23	APN	6	123741782	missense	possibly damaging	0.93
IGL03347:Vmn2r23	APN	6	123704374	missense	probably benign	0.01
IGL03396:Vmn2r23	APN	6	123729626	missense	probably damaging	1.00
PIT4472001:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R0597:Vmn2r23	UTSW	6	123729721	missense	probably benign	0.08
R0677:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R0904:Vmn2r23	UTSW	6	123742135	missense	probably damaging	1.00
R1330:Vmn2r23	UTSW	6	123742004	missense	probably damaging	1.00
R1424:Vmn2r23	UTSW	6	123713270	nonsense	probably null
R1629:Vmn2r23	UTSW	6	123713427	missense	probably benign	0.05
R1842:Vmn2r23	UTSW	6	123729690	missense	possibly damaging	0.77
R1867:Vmn2r23	UTSW	6	123702915	missense	probably damaging	1.00
R1919:Vmn2r23	UTSW	6	123713010	missense	possibly damaging	0.94
R2087:Vmn2r23	UTSW	6	123741499	missense	probably benign	0.00
R2338:Vmn2r23	UTSW	6	123704425	missense	possibly damaging	0.88
R2568:Vmn2r23	UTSW	6	123742188	nonsense	probably null
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R3500:Vmn2r23	UTSW	6	123713170	missense	possibly damaging	0.81
R3789:Vmn2r23	UTSW	6	123741389	missense	probably damaging	1.00
R4164:Vmn2r23	UTSW	6	123729738	missense	probably benign
R4506:Vmn2r23	UTSW	6	123702925	missense	probably damaging	1.00
R4652:Vmn2r23	UTSW	6	123741730	missense	probably damaging	1.00
R4697:Vmn2r23	UTSW	6	123741826	missense	probably damaging	1.00
R4840:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R4983:Vmn2r23	UTSW	6	123733349	missense	probably damaging	1.00
R5276:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R5392:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R5528:Vmn2r23	UTSW	6	123713002	missense	probably damaging	1.00
R5529:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R5664:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R5749:Vmn2r23	UTSW	6	123733273	missense	probably benign
R5761:Vmn2r23	UTSW	6	123712759	missense	probably benign	0.39
R5762:Vmn2r23	UTSW	6	123733393	missense	probably damaging	1.00
R5868:Vmn2r23	UTSW	6	123712942	missense	probably benign	0.12
R5935:Vmn2r23	UTSW	6	123741895	missense	possibly damaging	0.94
R6242:Vmn2r23	UTSW	6	123704400	missense	possibly damaging	0.82
R6416:Vmn2r23	UTSW	6	123712902	missense	probably damaging	1.00
R6524:Vmn2r23	UTSW	6	123713425	missense	probably damaging	1.00
R6576:Vmn2r23	UTSW	6	123733273	missense	probably benign
R6925:Vmn2r23	UTSW	6	123704553	missense	probably damaging	1.00
R7148:Vmn2r23	UTSW	6	123713022	missense	probably benign
R7215:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R7252:Vmn2r23	UTSW	6	123741581	missense	probably damaging	0.97
R7403:Vmn2r23	UTSW	6	123704579	missense	probably benign	0.01
R8015:Vmn2r23	UTSW	6	123704541	missense	probably benign	0.00
R8143:Vmn2r23	UTSW	6	123741353	missense	probably damaging	0.99
R8520:Vmn2r23	UTSW	6	123741656	missense	probably damaging	0.99
R8679:Vmn2r23	UTSW	6	123713472	missense	probably damaging	0.99
R8713:Vmn2r23	UTSW	6	123703032	missense
R8966:Vmn2r23	UTSW	6	123742120	missense	possibly damaging	0.94
RF018:Vmn2r23	UTSW	6	123713116	missense	probably benign	0.00
T0975:Vmn2r23	UTSW	6	123713161	missense	probably benign	0.00
Z1088:Vmn2r23	UTSW	6	123742108	missense	probably damaging	0.98
Z1177:Vmn2r23	UTSW	6	123729725	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CAATATGACCCTGGGATTCTCTC -3'
(R):5'- GGCAAAGGACATTTTCTTGGG -3'

Sequencing Primer
(F):5'- GGGATTCTCTCTCTTCAATGTTGAC -3'
(R):5'- CATTTTCTTGGGAGTGGTAAGAATAC -3'

Posted On

2021-01-18