Incidental Mutation 'R8474:Vmn2r23'
ID 657160
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Name vomeronasal 2, receptor 23
Synonyms EG435916
MMRRC Submission 067918-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R8474 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 123679780-123719198 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 123681599 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 169 (V169A)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
AlphaFold E9PXI5
Predicted Effect probably benign
Transcript: ENSMUST00000172391
AA Change: V169A

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: V169A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A T 15: 64,576,638 (GRCm39) S975T probably damaging Het
Adgrg1 C G 8: 95,729,936 (GRCm39) T46S probably damaging Het
Akip1 T A 7: 109,306,697 (GRCm39) D131E probably benign Het
Arhgef39 A G 4: 43,498,015 (GRCm39) V163A probably benign Het
Atg2a T C 19: 6,301,433 (GRCm39) probably null Het
Bcam A T 7: 19,494,325 (GRCm39) L357* probably null Het
Bcat2 A G 7: 45,237,075 (GRCm39) N194S probably damaging Het
Bcl2l14 T C 6: 134,400,720 (GRCm39) L47P probably benign Het
Cbln1 C T 8: 88,198,673 (GRCm39) A66T possibly damaging Het
Ccdc191 G T 16: 43,710,262 (GRCm39) probably benign Het
Cd70 C T 17: 57,456,468 (GRCm39) S45N possibly damaging Het
Cfap43 G A 19: 47,886,363 (GRCm39) A84V probably benign Het
Clca3a1 T A 3: 144,710,792 (GRCm39) N804Y possibly damaging Het
Cmah A T 13: 24,601,350 (GRCm39) N52I probably damaging Het
Crot A G 5: 9,043,518 (GRCm39) Y35H probably damaging Het
Cyp3a59 C A 5: 146,041,487 (GRCm39) P344T probably benign Het
Dnah5 A G 15: 28,247,978 (GRCm39) E705G probably benign Het
Dnm2 A G 9: 21,377,016 (GRCm39) Y125C probably damaging Het
Dst A G 1: 34,208,266 (GRCm39) Y739C probably damaging Het
Eif3a A T 19: 60,767,929 (GRCm39) M203K possibly damaging Het
Enpep C T 3: 129,113,076 (GRCm39) V283M probably damaging Het
Ephx3 A G 17: 32,407,219 (GRCm39) S240P probably damaging Het
Evi5l T C 8: 4,260,784 (GRCm39) H1011R possibly damaging Het
Fig4 A T 10: 41,108,170 (GRCm39) F677I probably benign Het
Gramd1b A G 9: 40,287,207 (GRCm39) probably null Het
Gse1 C T 8: 121,295,123 (GRCm39) probably benign Het
Hoxa9 A G 6: 52,202,506 (GRCm39) probably null Het
Ice1 A T 13: 70,752,566 (GRCm39) S1173R probably benign Het
Ifi207 G A 1: 173,556,605 (GRCm39) T718I possibly damaging Het
Ifit1bl1 A G 19: 34,572,262 (GRCm39) L65P probably damaging Het
Impact T C 18: 13,107,798 (GRCm39) I22T probably damaging Het
Lrp1 A G 10: 127,375,572 (GRCm39) C4409R probably damaging Het
Mark1 A G 1: 184,651,783 (GRCm39) W131R probably damaging Het
Mindy3 T C 2: 12,404,839 (GRCm39) T190A probably damaging Het
Mybbp1a A G 11: 72,338,563 (GRCm39) D721G probably benign Het
Myo1d A G 11: 80,561,745 (GRCm39) V466A possibly damaging Het
Myo5b A C 18: 74,903,411 (GRCm39) D1809A probably damaging Het
Nudcd2 C T 11: 40,624,850 (GRCm39) Q20* probably null Het
Or4f62 T C 2: 111,986,320 (GRCm39) M8T probably benign Het
Or5b101 A G 19: 13,005,357 (GRCm39) L112P probably damaging Het
Or8g2b T A 9: 39,751,048 (GRCm39) L106H possibly damaging Het
Pcif1 A T 2: 164,730,272 (GRCm39) D335V probably damaging Het
Pebp4 T A 14: 70,085,136 (GRCm39) C65S possibly damaging Het
Ptger1 C T 8: 84,395,267 (GRCm39) A248V probably benign Het
Qki A T 17: 10,537,747 (GRCm39) M19K probably benign Het
Ralgapa2 C G 2: 146,266,750 (GRCm39) A609P probably damaging Het
Robo2 C T 16: 73,745,150 (GRCm39) G875D probably damaging Het
Runx2 A G 17: 44,919,147 (GRCm39) V375A probably damaging Het
Sis A T 3: 72,836,730 (GRCm39) F841I probably damaging Het
Slc5a8 A G 10: 88,757,552 (GRCm39) D514G possibly damaging Het
Spag17 A T 3: 99,934,586 (GRCm39) T623S probably benign Het
Sppl2c A G 11: 104,078,963 (GRCm39) S588G probably benign Het
Stxbp6 A C 12: 44,949,704 (GRCm39) V75G possibly damaging Het
Tmc3 G A 7: 83,259,122 (GRCm39) R531Q probably damaging Het
Tmem258 T C 19: 10,184,550 (GRCm39) Y41H probably damaging Het
Tsks A T 7: 44,600,263 (GRCm39) T91S probably damaging Het
Wdr54 T C 6: 83,129,985 (GRCm39) N282S probably benign Het
Yme1l1 T A 2: 23,052,584 (GRCm39) N79K probably benign Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123,706,684 (GRCm39) missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123,706,555 (GRCm39) missense probably benign
IGL01073:Vmn2r23 APN 6 123,689,759 (GRCm39) missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123,681,383 (GRCm39) missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123,681,366 (GRCm39) missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123,718,845 (GRCm39) missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123,718,819 (GRCm39) missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123,718,703 (GRCm39) missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123,718,795 (GRCm39) missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123,681,437 (GRCm39) missense probably benign
IGL02831:Vmn2r23 APN 6 123,681,344 (GRCm39) missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123,681,355 (GRCm39) missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123,718,578 (GRCm39) missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123,718,741 (GRCm39) missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123,681,333 (GRCm39) missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123,706,585 (GRCm39) missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123,706,680 (GRCm39) missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123,719,094 (GRCm39) missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123,718,963 (GRCm39) missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123,690,229 (GRCm39) nonsense probably null
R1629:Vmn2r23 UTSW 6 123,690,386 (GRCm39) missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123,706,649 (GRCm39) missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123,679,874 (GRCm39) missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123,689,969 (GRCm39) missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123,718,458 (GRCm39) missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123,681,384 (GRCm39) missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123,719,147 (GRCm39) nonsense probably null
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123,690,129 (GRCm39) missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123,718,348 (GRCm39) missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123,706,697 (GRCm39) missense probably benign
R4506:Vmn2r23 UTSW 6 123,679,884 (GRCm39) missense probably damaging 1.00
R4652:Vmn2r23 UTSW 6 123,718,689 (GRCm39) missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123,718,785 (GRCm39) missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123,710,308 (GRCm39) missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123,689,961 (GRCm39) missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R5761:Vmn2r23 UTSW 6 123,689,718 (GRCm39) missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123,689,901 (GRCm39) missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123,718,854 (GRCm39) missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123,681,359 (GRCm39) missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123,689,861 (GRCm39) missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123,690,384 (GRCm39) missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R6925:Vmn2r23 UTSW 6 123,681,512 (GRCm39) missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123,689,981 (GRCm39) missense probably benign
R7215:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123,718,540 (GRCm39) missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123,681,538 (GRCm39) missense probably benign 0.01
R8015:Vmn2r23 UTSW 6 123,681,500 (GRCm39) missense probably benign 0.00
R8143:Vmn2r23 UTSW 6 123,718,312 (GRCm39) missense probably damaging 0.99
R8520:Vmn2r23 UTSW 6 123,718,615 (GRCm39) missense probably damaging 0.99
R8679:Vmn2r23 UTSW 6 123,690,431 (GRCm39) missense probably damaging 0.99
R8713:Vmn2r23 UTSW 6 123,679,991 (GRCm39) missense
R8966:Vmn2r23 UTSW 6 123,719,079 (GRCm39) missense possibly damaging 0.94
R9124:Vmn2r23 UTSW 6 123,719,038 (GRCm39) missense possibly damaging 0.57
R9163:Vmn2r23 UTSW 6 123,718,782 (GRCm39) missense probably damaging 1.00
R9189:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R9451:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R9495:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
R9514:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
RF018:Vmn2r23 UTSW 6 123,690,075 (GRCm39) missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123,690,120 (GRCm39) missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123,719,067 (GRCm39) missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123,706,684 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAATATGACCCTGGGATTCTCTC -3'
(R):5'- GGCAAAGGACATTTTCTTGGG -3'

Sequencing Primer
(F):5'- GGGATTCTCTCTCTTCAATGTTGAC -3'
(R):5'- CATTTTCTTGGGAGTGGTAAGAATAC -3'
Posted On 2021-01-18