Incidental Mutation 'R8474:Myo1d'
ID657180
Institutional Source Beutler Lab
Gene Symbol Myo1d
Ensembl Gene ENSMUSG00000035441
Gene Namemyosin ID
Synonyms9930104H07Rik, D11Ertd9e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8474 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location80482126-80780025 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80670919 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 466 (V466A)
Ref Sequence ENSEMBL: ENSMUSP00000066948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041065] [ENSMUST00000070997]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041065
AA Change: V466A

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441
AA Change: V466A

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 803 1006 4.1e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000070997
AA Change: V466A

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066948
Gene: ENSMUSG00000035441
AA Change: V466A

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 802 913 1.8e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A T 15: 64,704,789 S975T probably damaging Het
Adgrg1 C G 8: 95,003,308 T46S probably damaging Het
Akip1 T A 7: 109,707,490 D131E probably benign Het
Arhgef39 A G 4: 43,498,015 V163A probably benign Het
Atg2a T C 19: 6,251,403 probably null Het
Bcam A T 7: 19,760,400 L357* probably null Het
Bcat2 A G 7: 45,587,651 N194S probably damaging Het
Bcl2l14 T C 6: 134,423,757 L47P probably benign Het
Cbln1 C T 8: 87,472,045 A66T possibly damaging Het
Ccdc191 G T 16: 43,889,899 probably benign Het
Cd70 C T 17: 57,149,468 S45N possibly damaging Het
Cfap43 G A 19: 47,897,924 A84V probably benign Het
Clca1 T A 3: 145,005,031 N804Y possibly damaging Het
Cmah A T 13: 24,417,367 N52I probably damaging Het
Crot A G 5: 8,993,518 Y35H probably damaging Het
Cyp3a59 C A 5: 146,104,677 P344T probably benign Het
Dnah5 A G 15: 28,247,832 E705G probably benign Het
Dnm2 A G 9: 21,465,720 Y125C probably damaging Het
Dst A G 1: 34,169,185 Y739C probably damaging Het
Eif3a A T 19: 60,779,491 M203K possibly damaging Het
Enpep C T 3: 129,319,427 V283M probably damaging Het
Ephx3 A G 17: 32,188,245 S240P probably damaging Het
Evi5l T C 8: 4,210,784 H1011R possibly damaging Het
Fig4 A T 10: 41,232,174 F677I probably benign Het
Gramd1b A G 9: 40,375,911 probably null Het
Gse1 C T 8: 120,568,384 probably benign Het
Hoxa9 A G 6: 52,225,526 probably null Het
Ice1 A T 13: 70,604,447 S1173R probably benign Het
Ifi207 G A 1: 173,729,039 T718I possibly damaging Het
Ifit1bl1 A G 19: 34,594,862 L65P probably damaging Het
Impact T C 18: 12,974,741 I22T probably damaging Het
Lrp1 A G 10: 127,539,703 C4409R probably damaging Het
Mark1 A G 1: 184,919,586 W131R probably damaging Het
Mindy3 T C 2: 12,400,028 T190A probably damaging Het
Mybbp1a A G 11: 72,447,737 D721G probably benign Het
Myo5b A C 18: 74,770,340 D1809A probably damaging Het
Nudcd2 C T 11: 40,734,023 Q20* probably null Het
Olfr1318 T C 2: 112,155,975 M8T probably benign Het
Olfr1453 A G 19: 13,027,993 L112P probably damaging Het
Olfr971 T A 9: 39,839,752 L106H possibly damaging Het
Pcif1 A T 2: 164,888,352 D335V probably damaging Het
Pebp4 T A 14: 69,847,687 C65S possibly damaging Het
Ptger1 C T 8: 83,668,638 A248V probably benign Het
Qk A T 17: 10,318,818 M19K probably benign Het
Ralgapa2 C G 2: 146,424,830 A609P probably damaging Het
Robo2 C T 16: 73,948,262 G875D probably damaging Het
Runx2 A G 17: 44,608,260 V375A probably damaging Het
Sis A T 3: 72,929,397 F841I probably damaging Het
Slc5a8 A G 10: 88,921,690 D514G possibly damaging Het
Spag17 A T 3: 100,027,270 T623S probably benign Het
Sppl2c A G 11: 104,188,137 S588G probably benign Het
Stxbp6 A C 12: 44,902,921 V75G possibly damaging Het
Tmc3 G A 7: 83,609,914 R531Q probably damaging Het
Tmem258 T C 19: 10,207,186 Y41H probably damaging Het
Tsks A T 7: 44,950,839 T91S probably damaging Het
Vmn2r23 T C 6: 123,704,640 V169A probably benign Het
Wdr54 T C 6: 83,153,004 N282S probably benign Het
Yme1l1 T A 2: 23,162,572 N79K probably benign Het
Other mutations in Myo1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Myo1d APN 11 80601740 missense probably benign
IGL01087:Myo1d APN 11 80682435 missense probably damaging 1.00
IGL01326:Myo1d APN 11 80684321 splice site probably benign
IGL01431:Myo1d APN 11 80674839 missense probably damaging 1.00
IGL01595:Myo1d APN 11 80676110 missense probably benign 0.00
IGL01811:Myo1d APN 11 80692997 missense probably damaging 0.96
IGL02301:Myo1d APN 11 80676853 missense probably benign 0.23
IGL02388:Myo1d APN 11 80637997 nonsense probably null
IGL02485:Myo1d APN 11 80666581 missense probably damaging 1.00
IGL03017:Myo1d APN 11 80601626 missense probably benign 0.26
horton UTSW 11 80674708 missense probably damaging 1.00
multifaceted UTSW 11 80693072 missense probably damaging 1.00
whisper UTSW 11 80484332 missense probably damaging 0.99
whisper2 UTSW 11 80666578 missense probably damaging 1.00
whisper3 UTSW 11 80557521 missense probably damaging 1.00
R0069:Myo1d UTSW 11 80637953 missense probably damaging 1.00
R0069:Myo1d UTSW 11 80637953 missense probably damaging 1.00
R0081:Myo1d UTSW 11 80557523 missense probably benign 0.00
R0096:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0096:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0244:Myo1d UTSW 11 80674708 missense probably damaging 1.00
R0711:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0746:Myo1d UTSW 11 80586879 missense possibly damaging 0.94
R1084:Myo1d UTSW 11 80684395 missense probably damaging 1.00
R1514:Myo1d UTSW 11 80685908 missense probably damaging 0.97
R1676:Myo1d UTSW 11 80684421 missense probably damaging 1.00
R1862:Myo1d UTSW 11 80663048 missense probably damaging 1.00
R2497:Myo1d UTSW 11 80674821 missense probably damaging 1.00
R2512:Myo1d UTSW 11 80779717 missense probably benign 0.00
R3425:Myo1d UTSW 11 80601638 missense probably benign
R3429:Myo1d UTSW 11 80682410 missense probably damaging 1.00
R3917:Myo1d UTSW 11 80666578 missense probably damaging 1.00
R3928:Myo1d UTSW 11 80484261 missense probably benign 0.09
R4706:Myo1d UTSW 11 80666641 missense probably damaging 0.96
R4723:Myo1d UTSW 11 80779841 utr 5 prime probably benign
R4924:Myo1d UTSW 11 80674678 missense probably damaging 1.00
R5042:Myo1d UTSW 11 80557521 missense probably damaging 1.00
R5320:Myo1d UTSW 11 80684323 critical splice donor site probably null
R5481:Myo1d UTSW 11 80663095 missense possibly damaging 0.79
R6214:Myo1d UTSW 11 80779791 start codon destroyed probably null 0.98
R6235:Myo1d UTSW 11 80692944 missense probably benign 0.23
R6282:Myo1d UTSW 11 80557512 missense probably damaging 0.99
R6468:Myo1d UTSW 11 80557474 missense probably benign 0.00
R6668:Myo1d UTSW 11 80583875 intron probably benign
R6954:Myo1d UTSW 11 80674957 missense probably benign 0.21
R7077:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7078:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7080:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7172:Myo1d UTSW 11 80592795 missense probably benign 0.16
R7276:Myo1d UTSW 11 80693072 missense probably damaging 1.00
R7467:Myo1d UTSW 11 80586917 missense probably damaging 1.00
R7650:Myo1d UTSW 11 80601684 missense probably benign
R7678:Myo1d UTSW 11 80676893 missense possibly damaging 0.80
R7859:Myo1d UTSW 11 80684377 missense probably damaging 1.00
R8324:Myo1d UTSW 11 80557521 missense probably damaging 1.00
R8329:Myo1d UTSW 11 80638074 missense probably benign 0.21
R8799:Myo1d UTSW 11 80684379 missense probably damaging 1.00
R8810:Myo1d UTSW 11 80674932 missense probably damaging 1.00
R8810:Myo1d UTSW 11 80676932 missense probably benign 0.30
R8823:Myo1d UTSW 11 80601745 missense possibly damaging 0.91
Z1088:Myo1d UTSW 11 80674898 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCACTGTATCAGAGAAGCAG -3'
(R):5'- GGACACCTATGTGCTTGCTTG -3'

Sequencing Primer
(F):5'- TGTATCAGAGAAGCAGAACTCAC -3'
(R):5'- ACACCTATGTGCTTGCTTGTTGAG -3'
Posted On2021-01-18