Mutagenetix > Incidental Mutations

Incidental Mutation 'R8474:Ice1'

657184

Institutional Source

Beutler Lab

Gene Symbol

Ice1

Ensembl Gene

ENSMUSG00000034525

Gene Name

interactor of little elongation complex ELL subunit 1

Synonyms

BC018507

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.952) question?

Stock #

R8474 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

70551707-70637634 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 70604447 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 1173 (S1173R)

Ref Sequence

ENSEMBL: ENSMUSP00000036482 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637] [ENSMUST00000222568]

AlphaFold

E9Q286

Predicted Effect

probably benign
Transcript: ENSMUST00000043493
AA Change: S1173R

PolyPhen 2 Score 0.422 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: S1173R

Domain	Start	End	E-Value	Type
coiled coil region	22	185	N/A	INTRINSIC
low complexity region	276	292	N/A	INTRINSIC
low complexity region	338	351	N/A	INTRINSIC
low complexity region	372	378	N/A	INTRINSIC
low complexity region	469	481	N/A	INTRINSIC
low complexity region	606	619	N/A	INTRINSIC
low complexity region	769	780	N/A	INTRINSIC
low complexity region	946	958	N/A	INTRINSIC
low complexity region	1061	1073	N/A	INTRINSIC
low complexity region	1329	1352	N/A	INTRINSIC
low complexity region	1595	1604	N/A	INTRINSIC
low complexity region	1656	1671	N/A	INTRINSIC
SCOP:d1gw5a_	2026	2223	5e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000220637

Predicted Effect

probably benign
Transcript: ENSMUST00000222568

Predicted Effect

probably benign
Transcript: ENSMUST00000222627

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy8	A	T	15: 64,704,789	S975T	probably damaging	Het
Adgrg1	C	G	8: 95,003,308	T46S	probably damaging	Het
Akip1	T	A	7: 109,707,490	D131E	probably benign	Het
Arhgef39	A	G	4: 43,498,015	V163A	probably benign	Het
Atg2a	T	C	19: 6,251,403		probably null	Het
Bcam	A	T	7: 19,760,400	L357*	probably null	Het
Bcat2	A	G	7: 45,587,651	N194S	probably damaging	Het
Bcl2l14	T	C	6: 134,423,757	L47P	probably benign	Het
Cbln1	C	T	8: 87,472,045	A66T	possibly damaging	Het
Ccdc191	G	T	16: 43,889,899		probably benign	Het
Cd70	C	T	17: 57,149,468	S45N	possibly damaging	Het
Cfap43	G	A	19: 47,897,924	A84V	probably benign	Het
Clca1	T	A	3: 145,005,031	N804Y	possibly damaging	Het
Cmah	A	T	13: 24,417,367	N52I	probably damaging	Het
Crot	A	G	5: 8,993,518	Y35H	probably damaging	Het
Cyp3a59	C	A	5: 146,104,677	P344T	probably benign	Het
Dnah5	A	G	15: 28,247,832	E705G	probably benign	Het
Dnm2	A	G	9: 21,465,720	Y125C	probably damaging	Het
Dst	A	G	1: 34,169,185	Y739C	probably damaging	Het
Eif3a	A	T	19: 60,779,491	M203K	possibly damaging	Het
Enpep	C	T	3: 129,319,427	V283M	probably damaging	Het
Ephx3	A	G	17: 32,188,245	S240P	probably damaging	Het
Evi5l	T	C	8: 4,210,784	H1011R	possibly damaging	Het
Fig4	A	T	10: 41,232,174	F677I	probably benign	Het
Gramd1b	A	G	9: 40,375,911		probably null	Het
Gse1	C	T	8: 120,568,384		probably benign	Het
Hoxa9	A	G	6: 52,225,526		probably null	Het
Ifi207	G	A	1: 173,729,039	T718I	possibly damaging	Het
Ifit1bl1	A	G	19: 34,594,862	L65P	probably damaging	Het
Impact	T	C	18: 12,974,741	I22T	probably damaging	Het
Lrp1	A	G	10: 127,539,703	C4409R	probably damaging	Het
Mark1	A	G	1: 184,919,586	W131R	probably damaging	Het
Mindy3	T	C	2: 12,400,028	T190A	probably damaging	Het
Mybbp1a	A	G	11: 72,447,737	D721G	probably benign	Het
Myo1d	A	G	11: 80,670,919	V466A	possibly damaging	Het
Myo5b	A	C	18: 74,770,340	D1809A	probably damaging	Het
Nudcd2	C	T	11: 40,734,023	Q20*	probably null	Het
Olfr1318	T	C	2: 112,155,975	M8T	probably benign	Het
Olfr1453	A	G	19: 13,027,993	L112P	probably damaging	Het
Olfr971	T	A	9: 39,839,752	L106H	possibly damaging	Het
Pcif1	A	T	2: 164,888,352	D335V	probably damaging	Het
Pebp4	T	A	14: 69,847,687	C65S	possibly damaging	Het
Ptger1	C	T	8: 83,668,638	A248V	probably benign	Het
Qk	A	T	17: 10,318,818	M19K	probably benign	Het
Ralgapa2	C	G	2: 146,424,830	A609P	probably damaging	Het
Robo2	C	T	16: 73,948,262	G875D	probably damaging	Het
Runx2	A	G	17: 44,608,260	V375A	probably damaging	Het
Sis	A	T	3: 72,929,397	F841I	probably damaging	Het
Slc5a8	A	G	10: 88,921,690	D514G	possibly damaging	Het
Spag17	A	T	3: 100,027,270	T623S	probably benign	Het
Sppl2c	A	G	11: 104,188,137	S588G	probably benign	Het
Stxbp6	A	C	12: 44,902,921	V75G	possibly damaging	Het
Tmc3	G	A	7: 83,609,914	R531Q	probably damaging	Het
Tmem258	T	C	19: 10,207,186	Y41H	probably damaging	Het
Tsks	A	T	7: 44,950,839	T91S	probably damaging	Het
Vmn2r23	T	C	6: 123,704,640	V169A	probably benign	Het
Wdr54	T	C	6: 83,153,004	N282S	probably benign	Het
Yme1l1	T	A	2: 23,162,572	N79K	probably benign	Het

Other mutations in Ice1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00904:Ice1	APN	13	70602289	missense	probably damaging	1.00
IGL01155:Ice1	APN	13	70604082	missense	possibly damaging	0.93
IGL01298:Ice1	APN	13	70604904	missense	possibly damaging	0.93
IGL01797:Ice1	APN	13	70623946	missense	probably damaging	1.00
IGL02423:Ice1	APN	13	70592599	missense	probably damaging	1.00
IGL02583:Ice1	APN	13	70605735	missense	possibly damaging	0.80
IGL02794:Ice1	APN	13	70609159	missense	possibly damaging	0.95
IGL02882:Ice1	APN	13	70624474	splice site	probably benign
IGL02929:Ice1	APN	13	70596203	missense	probably damaging	1.00
IGL03343:Ice1	APN	13	70602929	missense	probably damaging	1.00
IGL03384:Ice1	APN	13	70603249	missense	probably benign	0.00
PIT4651001:Ice1	UTSW	13	70623921	critical splice donor site	probably null
R0078:Ice1	UTSW	13	70603348	missense	probably damaging	0.98
R0081:Ice1	UTSW	13	70619044	nonsense	probably null
R0281:Ice1	UTSW	13	70604047	missense	possibly damaging	0.64
R0557:Ice1	UTSW	13	70601191	missense	probably benign	0.08
R0973:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R0973:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R0974:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R1033:Ice1	UTSW	13	70606594	missense	probably damaging	0.96
R1371:Ice1	UTSW	13	70596221	missense	probably damaging	1.00
R1525:Ice1	UTSW	13	70605410	missense	probably benign	0.01
R1539:Ice1	UTSW	13	70605904	missense	probably damaging	1.00
R1596:Ice1	UTSW	13	70604895	missense	possibly damaging	0.94
R1603:Ice1	UTSW	13	70603353	missense	probably benign	0.01
R1680:Ice1	UTSW	13	70605448	missense	probably benign	0.00
R1737:Ice1	UTSW	13	70606325	missense	probably damaging	0.99
R1766:Ice1	UTSW	13	70604442	missense	possibly damaging	0.78
R1774:Ice1	UTSW	13	70604553	missense	probably damaging	1.00
R1834:Ice1	UTSW	13	70615338	missense	probably damaging	0.99
R1840:Ice1	UTSW	13	70606218	missense	probably benign	0.00
R1898:Ice1	UTSW	13	70602307	missense	possibly damaging	0.83
R1930:Ice1	UTSW	13	70605083	missense	probably benign	0.18
R2000:Ice1	UTSW	13	70602427	missense	possibly damaging	0.58
R2106:Ice1	UTSW	13	70605622	missense	probably benign	0.00
R2293:Ice1	UTSW	13	70614957	missense	probably damaging	1.00
R2377:Ice1	UTSW	13	70602780	missense	probably damaging	1.00
R2909:Ice1	UTSW	13	70596173	missense	probably damaging	1.00
R2965:Ice1	UTSW	13	70602578	missense	probably benign	0.31
R3730:Ice1	UTSW	13	70603240	missense	probably damaging	1.00
R3886:Ice1	UTSW	13	70605370	missense	probably benign	0.00
R3914:Ice1	UTSW	13	70606084	missense	probably benign	0.30
R4051:Ice1	UTSW	13	70603527	missense	probably damaging	1.00
R4321:Ice1	UTSW	13	70603110	missense	possibly damaging	0.83
R4499:Ice1	UTSW	13	70609027	missense	possibly damaging	0.87
R4729:Ice1	UTSW	13	70606384	missense	probably damaging	1.00
R5078:Ice1	UTSW	13	70604850	missense	probably benign
R5431:Ice1	UTSW	13	70592650	missense	probably damaging	1.00
R5722:Ice1	UTSW	13	70615100	missense	possibly damaging	0.95
R5881:Ice1	UTSW	13	70606501	missense	probably benign	0.04
R5914:Ice1	UTSW	13	70606377	missense	possibly damaging	0.93
R6171:Ice1	UTSW	13	70606731	missense	probably benign
R6253:Ice1	UTSW	13	70603164	missense	probably damaging	1.00
R6274:Ice1	UTSW	13	70594839	missense	probably damaging	0.97
R6518:Ice1	UTSW	13	70606309	missense	possibly damaging	0.89
R6665:Ice1	UTSW	13	70603473	missense	possibly damaging	0.85
R6714:Ice1	UTSW	13	70615263	splice site	probably null
R6853:Ice1	UTSW	13	70603302	missense	possibly damaging	0.92
R6917:Ice1	UTSW	13	70594894	missense	probably damaging	1.00
R7032:Ice1	UTSW	13	70596164	missense	probably damaging	0.99
R7176:Ice1	UTSW	13	70624406	critical splice donor site	probably null
R7352:Ice1	UTSW	13	70606102	nonsense	probably null
R7445:Ice1	UTSW	13	70596167	missense
R7646:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7647:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7648:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7650:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7650:Ice1	UTSW	13	70605483	missense	probably damaging	1.00
R7812:Ice1	UTSW	13	70603005	missense	possibly damaging	0.63
R8061:Ice1	UTSW	13	70603732	missense	probably damaging	1.00
R8129:Ice1	UTSW	13	70606201	missense	probably benign	0.02
R8283:Ice1	UTSW	13	70604430	missense	probably damaging	0.97
R8303:Ice1	UTSW	13	70606407	missense	probably benign	0.04
R8444:Ice1	UTSW	13	70604376	missense	probably damaging	1.00
R8751:Ice1	UTSW	13	70602891	missense	probably damaging	1.00
R8887:Ice1	UTSW	13	70602931	missense	probably damaging	1.00
R8911:Ice1	UTSW	13	70592668	missense
R8954:Ice1	UTSW	13	70610578	missense	probably damaging	1.00
R9345:Ice1	UTSW	13	70592639	missense
R9438:Ice1	UTSW	13	70606315	missense	probably benign	0.04
X0026:Ice1	UTSW	13	70592602	missense	probably damaging	1.00
Z1176:Ice1	UTSW	13	70605201	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGTCCACAGGGTTTGTATCG -3'
(R):5'- CCCCTCAGATGTAGGTGATCTG -3'

Sequencing Primer
(F):5'- TGAGAACGTCAGATGGCACTTCC -3'
(R):5'- CAGATGTAGGTGATCTGACCTCC -3'

Posted On

2021-01-18