Incidental Mutation 'R8474:Ice1'
ID 657184
Institutional Source Beutler Lab
Gene Symbol Ice1
Ensembl Gene ENSMUSG00000034525
Gene Name interactor of little elongation complex ELL subunit 1
Synonyms BC018507
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock # R8474 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 70551707-70637634 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 70604447 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 1173 (S1173R)
Ref Sequence ENSEMBL: ENSMUSP00000036482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637] [ENSMUST00000222568]
AlphaFold E9Q286
Predicted Effect probably benign
Transcript: ENSMUST00000043493
AA Change: S1173R

PolyPhen 2 Score 0.422 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: S1173R

DomainStartEndE-ValueType
coiled coil region 22 185 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 338 351 N/A INTRINSIC
low complexity region 372 378 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 946 958 N/A INTRINSIC
low complexity region 1061 1073 N/A INTRINSIC
low complexity region 1329 1352 N/A INTRINSIC
low complexity region 1595 1604 N/A INTRINSIC
low complexity region 1656 1671 N/A INTRINSIC
SCOP:d1gw5a_ 2026 2223 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220637
Predicted Effect probably benign
Transcript: ENSMUST00000222568
Predicted Effect probably benign
Transcript: ENSMUST00000222627
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A T 15: 64,704,789 S975T probably damaging Het
Adgrg1 C G 8: 95,003,308 T46S probably damaging Het
Akip1 T A 7: 109,707,490 D131E probably benign Het
Arhgef39 A G 4: 43,498,015 V163A probably benign Het
Atg2a T C 19: 6,251,403 probably null Het
Bcam A T 7: 19,760,400 L357* probably null Het
Bcat2 A G 7: 45,587,651 N194S probably damaging Het
Bcl2l14 T C 6: 134,423,757 L47P probably benign Het
Cbln1 C T 8: 87,472,045 A66T possibly damaging Het
Ccdc191 G T 16: 43,889,899 probably benign Het
Cd70 C T 17: 57,149,468 S45N possibly damaging Het
Cfap43 G A 19: 47,897,924 A84V probably benign Het
Clca1 T A 3: 145,005,031 N804Y possibly damaging Het
Cmah A T 13: 24,417,367 N52I probably damaging Het
Crot A G 5: 8,993,518 Y35H probably damaging Het
Cyp3a59 C A 5: 146,104,677 P344T probably benign Het
Dnah5 A G 15: 28,247,832 E705G probably benign Het
Dnm2 A G 9: 21,465,720 Y125C probably damaging Het
Dst A G 1: 34,169,185 Y739C probably damaging Het
Eif3a A T 19: 60,779,491 M203K possibly damaging Het
Enpep C T 3: 129,319,427 V283M probably damaging Het
Ephx3 A G 17: 32,188,245 S240P probably damaging Het
Evi5l T C 8: 4,210,784 H1011R possibly damaging Het
Fig4 A T 10: 41,232,174 F677I probably benign Het
Gramd1b A G 9: 40,375,911 probably null Het
Gse1 C T 8: 120,568,384 probably benign Het
Hoxa9 A G 6: 52,225,526 probably null Het
Ifi207 G A 1: 173,729,039 T718I possibly damaging Het
Ifit1bl1 A G 19: 34,594,862 L65P probably damaging Het
Impact T C 18: 12,974,741 I22T probably damaging Het
Lrp1 A G 10: 127,539,703 C4409R probably damaging Het
Mark1 A G 1: 184,919,586 W131R probably damaging Het
Mindy3 T C 2: 12,400,028 T190A probably damaging Het
Mybbp1a A G 11: 72,447,737 D721G probably benign Het
Myo1d A G 11: 80,670,919 V466A possibly damaging Het
Myo5b A C 18: 74,770,340 D1809A probably damaging Het
Nudcd2 C T 11: 40,734,023 Q20* probably null Het
Olfr1318 T C 2: 112,155,975 M8T probably benign Het
Olfr1453 A G 19: 13,027,993 L112P probably damaging Het
Olfr971 T A 9: 39,839,752 L106H possibly damaging Het
Pcif1 A T 2: 164,888,352 D335V probably damaging Het
Pebp4 T A 14: 69,847,687 C65S possibly damaging Het
Ptger1 C T 8: 83,668,638 A248V probably benign Het
Qk A T 17: 10,318,818 M19K probably benign Het
Ralgapa2 C G 2: 146,424,830 A609P probably damaging Het
Robo2 C T 16: 73,948,262 G875D probably damaging Het
Runx2 A G 17: 44,608,260 V375A probably damaging Het
Sis A T 3: 72,929,397 F841I probably damaging Het
Slc5a8 A G 10: 88,921,690 D514G possibly damaging Het
Spag17 A T 3: 100,027,270 T623S probably benign Het
Sppl2c A G 11: 104,188,137 S588G probably benign Het
Stxbp6 A C 12: 44,902,921 V75G possibly damaging Het
Tmc3 G A 7: 83,609,914 R531Q probably damaging Het
Tmem258 T C 19: 10,207,186 Y41H probably damaging Het
Tsks A T 7: 44,950,839 T91S probably damaging Het
Vmn2r23 T C 6: 123,704,640 V169A probably benign Het
Wdr54 T C 6: 83,153,004 N282S probably benign Het
Yme1l1 T A 2: 23,162,572 N79K probably benign Het
Other mutations in Ice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ice1 APN 13 70602289 missense probably damaging 1.00
IGL01155:Ice1 APN 13 70604082 missense possibly damaging 0.93
IGL01298:Ice1 APN 13 70604904 missense possibly damaging 0.93
IGL01797:Ice1 APN 13 70623946 missense probably damaging 1.00
IGL02423:Ice1 APN 13 70592599 missense probably damaging 1.00
IGL02583:Ice1 APN 13 70605735 missense possibly damaging 0.80
IGL02794:Ice1 APN 13 70609159 missense possibly damaging 0.95
IGL02882:Ice1 APN 13 70624474 splice site probably benign
IGL02929:Ice1 APN 13 70596203 missense probably damaging 1.00
IGL03343:Ice1 APN 13 70602929 missense probably damaging 1.00
IGL03384:Ice1 APN 13 70603249 missense probably benign 0.00
PIT4651001:Ice1 UTSW 13 70623921 critical splice donor site probably null
R0078:Ice1 UTSW 13 70603348 missense probably damaging 0.98
R0081:Ice1 UTSW 13 70619044 nonsense probably null
R0281:Ice1 UTSW 13 70604047 missense possibly damaging 0.64
R0557:Ice1 UTSW 13 70601191 missense probably benign 0.08
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0974:Ice1 UTSW 13 70602427 missense probably benign 0.04
R1033:Ice1 UTSW 13 70606594 missense probably damaging 0.96
R1371:Ice1 UTSW 13 70596221 missense probably damaging 1.00
R1525:Ice1 UTSW 13 70605410 missense probably benign 0.01
R1539:Ice1 UTSW 13 70605904 missense probably damaging 1.00
R1596:Ice1 UTSW 13 70604895 missense possibly damaging 0.94
R1603:Ice1 UTSW 13 70603353 missense probably benign 0.01
R1680:Ice1 UTSW 13 70605448 missense probably benign 0.00
R1737:Ice1 UTSW 13 70606325 missense probably damaging 0.99
R1766:Ice1 UTSW 13 70604442 missense possibly damaging 0.78
R1774:Ice1 UTSW 13 70604553 missense probably damaging 1.00
R1834:Ice1 UTSW 13 70615338 missense probably damaging 0.99
R1840:Ice1 UTSW 13 70606218 missense probably benign 0.00
R1898:Ice1 UTSW 13 70602307 missense possibly damaging 0.83
R1930:Ice1 UTSW 13 70605083 missense probably benign 0.18
R2000:Ice1 UTSW 13 70602427 missense possibly damaging 0.58
R2106:Ice1 UTSW 13 70605622 missense probably benign 0.00
R2293:Ice1 UTSW 13 70614957 missense probably damaging 1.00
R2377:Ice1 UTSW 13 70602780 missense probably damaging 1.00
R2909:Ice1 UTSW 13 70596173 missense probably damaging 1.00
R2965:Ice1 UTSW 13 70602578 missense probably benign 0.31
R3730:Ice1 UTSW 13 70603240 missense probably damaging 1.00
R3886:Ice1 UTSW 13 70605370 missense probably benign 0.00
R3914:Ice1 UTSW 13 70606084 missense probably benign 0.30
R4051:Ice1 UTSW 13 70603527 missense probably damaging 1.00
R4321:Ice1 UTSW 13 70603110 missense possibly damaging 0.83
R4499:Ice1 UTSW 13 70609027 missense possibly damaging 0.87
R4729:Ice1 UTSW 13 70606384 missense probably damaging 1.00
R5078:Ice1 UTSW 13 70604850 missense probably benign
R5431:Ice1 UTSW 13 70592650 missense probably damaging 1.00
R5722:Ice1 UTSW 13 70615100 missense possibly damaging 0.95
R5881:Ice1 UTSW 13 70606501 missense probably benign 0.04
R5914:Ice1 UTSW 13 70606377 missense possibly damaging 0.93
R6171:Ice1 UTSW 13 70606731 missense probably benign
R6253:Ice1 UTSW 13 70603164 missense probably damaging 1.00
R6274:Ice1 UTSW 13 70594839 missense probably damaging 0.97
R6518:Ice1 UTSW 13 70606309 missense possibly damaging 0.89
R6665:Ice1 UTSW 13 70603473 missense possibly damaging 0.85
R6714:Ice1 UTSW 13 70615263 splice site probably null
R6853:Ice1 UTSW 13 70603302 missense possibly damaging 0.92
R6917:Ice1 UTSW 13 70594894 missense probably damaging 1.00
R7032:Ice1 UTSW 13 70596164 missense probably damaging 0.99
R7176:Ice1 UTSW 13 70624406 critical splice donor site probably null
R7352:Ice1 UTSW 13 70606102 nonsense probably null
R7445:Ice1 UTSW 13 70596167 missense
R7646:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7647:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7648:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70605483 missense probably damaging 1.00
R7812:Ice1 UTSW 13 70603005 missense possibly damaging 0.63
R8061:Ice1 UTSW 13 70603732 missense probably damaging 1.00
R8129:Ice1 UTSW 13 70606201 missense probably benign 0.02
R8283:Ice1 UTSW 13 70604430 missense probably damaging 0.97
R8303:Ice1 UTSW 13 70606407 missense probably benign 0.04
R8444:Ice1 UTSW 13 70604376 missense probably damaging 1.00
R8751:Ice1 UTSW 13 70602891 missense probably damaging 1.00
R8887:Ice1 UTSW 13 70602931 missense probably damaging 1.00
R8911:Ice1 UTSW 13 70592668 missense
R8954:Ice1 UTSW 13 70610578 missense probably damaging 1.00
R9345:Ice1 UTSW 13 70592639 missense
R9438:Ice1 UTSW 13 70606315 missense probably benign 0.04
X0026:Ice1 UTSW 13 70592602 missense probably damaging 1.00
Z1176:Ice1 UTSW 13 70605201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTCCACAGGGTTTGTATCG -3'
(R):5'- CCCCTCAGATGTAGGTGATCTG -3'

Sequencing Primer
(F):5'- TGAGAACGTCAGATGGCACTTCC -3'
(R):5'- CAGATGTAGGTGATCTGACCTCC -3'
Posted On 2021-01-18