Incidental Mutation 'R8474:Cd70'
ID 657193
Institutional Source Beutler Lab
Gene Symbol Cd70
Ensembl Gene ENSMUSG00000019489
Gene Name CD70 antigen
Synonyms Ki-24 antigen, CD27LG, Tnfsf7
MMRRC Submission 067918-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8474 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 57452997-57456777 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 57456468 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 45 (S45N)
Ref Sequence ENSEMBL: ENSMUSP00000019633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019633]
AlphaFold O55237
Predicted Effect possibly damaging
Transcript: ENSMUST00000019633
AA Change: S45N

PolyPhen 2 Score 0.457 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000019633
Gene: ENSMUSG00000019489
AA Change: S45N

DomainStartEndE-ValueType
transmembrane domain 22 44 N/A INTRINSIC
TNF 63 193 2.08e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for TNFRSF27/CD27. It is a surface antigen on activated, but not on resting, T and B lymphocytes. It induces proliferation of costimulated T cells, enhances the generation of cytolytic T cells, and contributes to T cell activation. This cytokine is also reported to play a role in regulating B-cell activation, cytotoxic function of natural killer cells, and immunoglobulin sythesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Expansion of CD8+ cells after viral expansion is significantly less in mice with a homozygous deletion than in controls. However, the restimulation response is comparable to controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A T 15: 64,576,638 (GRCm39) S975T probably damaging Het
Adgrg1 C G 8: 95,729,936 (GRCm39) T46S probably damaging Het
Akip1 T A 7: 109,306,697 (GRCm39) D131E probably benign Het
Arhgef39 A G 4: 43,498,015 (GRCm39) V163A probably benign Het
Atg2a T C 19: 6,301,433 (GRCm39) probably null Het
Bcam A T 7: 19,494,325 (GRCm39) L357* probably null Het
Bcat2 A G 7: 45,237,075 (GRCm39) N194S probably damaging Het
Bcl2l14 T C 6: 134,400,720 (GRCm39) L47P probably benign Het
Cbln1 C T 8: 88,198,673 (GRCm39) A66T possibly damaging Het
Ccdc191 G T 16: 43,710,262 (GRCm39) probably benign Het
Cfap43 G A 19: 47,886,363 (GRCm39) A84V probably benign Het
Clca3a1 T A 3: 144,710,792 (GRCm39) N804Y possibly damaging Het
Cmah A T 13: 24,601,350 (GRCm39) N52I probably damaging Het
Crot A G 5: 9,043,518 (GRCm39) Y35H probably damaging Het
Cyp3a59 C A 5: 146,041,487 (GRCm39) P344T probably benign Het
Dnah5 A G 15: 28,247,978 (GRCm39) E705G probably benign Het
Dnm2 A G 9: 21,377,016 (GRCm39) Y125C probably damaging Het
Dst A G 1: 34,208,266 (GRCm39) Y739C probably damaging Het
Eif3a A T 19: 60,767,929 (GRCm39) M203K possibly damaging Het
Enpep C T 3: 129,113,076 (GRCm39) V283M probably damaging Het
Ephx3 A G 17: 32,407,219 (GRCm39) S240P probably damaging Het
Evi5l T C 8: 4,260,784 (GRCm39) H1011R possibly damaging Het
Fig4 A T 10: 41,108,170 (GRCm39) F677I probably benign Het
Gramd1b A G 9: 40,287,207 (GRCm39) probably null Het
Gse1 C T 8: 121,295,123 (GRCm39) probably benign Het
Hoxa9 A G 6: 52,202,506 (GRCm39) probably null Het
Ice1 A T 13: 70,752,566 (GRCm39) S1173R probably benign Het
Ifi207 G A 1: 173,556,605 (GRCm39) T718I possibly damaging Het
Ifit1bl1 A G 19: 34,572,262 (GRCm39) L65P probably damaging Het
Impact T C 18: 13,107,798 (GRCm39) I22T probably damaging Het
Lrp1 A G 10: 127,375,572 (GRCm39) C4409R probably damaging Het
Mark1 A G 1: 184,651,783 (GRCm39) W131R probably damaging Het
Mindy3 T C 2: 12,404,839 (GRCm39) T190A probably damaging Het
Mybbp1a A G 11: 72,338,563 (GRCm39) D721G probably benign Het
Myo1d A G 11: 80,561,745 (GRCm39) V466A possibly damaging Het
Myo5b A C 18: 74,903,411 (GRCm39) D1809A probably damaging Het
Nudcd2 C T 11: 40,624,850 (GRCm39) Q20* probably null Het
Or4f62 T C 2: 111,986,320 (GRCm39) M8T probably benign Het
Or5b101 A G 19: 13,005,357 (GRCm39) L112P probably damaging Het
Or8g2b T A 9: 39,751,048 (GRCm39) L106H possibly damaging Het
Pcif1 A T 2: 164,730,272 (GRCm39) D335V probably damaging Het
Pebp4 T A 14: 70,085,136 (GRCm39) C65S possibly damaging Het
Ptger1 C T 8: 84,395,267 (GRCm39) A248V probably benign Het
Qki A T 17: 10,537,747 (GRCm39) M19K probably benign Het
Ralgapa2 C G 2: 146,266,750 (GRCm39) A609P probably damaging Het
Robo2 C T 16: 73,745,150 (GRCm39) G875D probably damaging Het
Runx2 A G 17: 44,919,147 (GRCm39) V375A probably damaging Het
Sis A T 3: 72,836,730 (GRCm39) F841I probably damaging Het
Slc5a8 A G 10: 88,757,552 (GRCm39) D514G possibly damaging Het
Spag17 A T 3: 99,934,586 (GRCm39) T623S probably benign Het
Sppl2c A G 11: 104,078,963 (GRCm39) S588G probably benign Het
Stxbp6 A C 12: 44,949,704 (GRCm39) V75G possibly damaging Het
Tmc3 G A 7: 83,259,122 (GRCm39) R531Q probably damaging Het
Tmem258 T C 19: 10,184,550 (GRCm39) Y41H probably damaging Het
Tsks A T 7: 44,600,263 (GRCm39) T91S probably damaging Het
Vmn2r23 T C 6: 123,681,599 (GRCm39) V169A probably benign Het
Wdr54 T C 6: 83,129,985 (GRCm39) N282S probably benign Het
Yme1l1 T A 2: 23,052,584 (GRCm39) N79K probably benign Het
Other mutations in Cd70
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1575:Cd70 UTSW 17 57,453,364 (GRCm39) missense probably damaging 0.97
R1723:Cd70 UTSW 17 57,453,401 (GRCm39) missense possibly damaging 0.55
R4998:Cd70 UTSW 17 57,453,311 (GRCm39) missense probably damaging 1.00
R6602:Cd70 UTSW 17 57,456,562 (GRCm39) missense probably benign 0.00
R6948:Cd70 UTSW 17 57,456,594 (GRCm39) missense probably damaging 1.00
R7871:Cd70 UTSW 17 57,455,770 (GRCm39) missense probably damaging 1.00
R9136:Cd70 UTSW 17 57,453,152 (GRCm39) missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TGACATCTTTCCCAGTCCGG -3'
(R):5'- CTTCAAAAGCTCGGCTGAGG -3'

Sequencing Primer
(F):5'- TGGCCTCCATAGTCGGC -3'
(R):5'- GCTGAGGAGGCTACAGCTTC -3'
Posted On 2021-01-18