Incidental Mutation 'R8475:1700123K08Rik'
ID657220
Institutional Source Beutler Lab
Gene Symbol 1700123K08Rik
Ensembl Gene ENSMUSG00000029526
Gene NameRIKEN cDNA 1700123K08 gene
Synonyms
Accession Numbers

NCBI RefSeq: NM_029693.2; MGI:1923908

Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R8475 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location138561840-138564712 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 138562926 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 158 (T158M)
Ref Sequence ENSEMBL: ENSMUSP00000031501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031501]
Predicted Effect probably benign
Transcript: ENSMUST00000031501
AA Change: T158M

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000031501
Gene: ENSMUSG00000029526
AA Change: T158M

DomainStartEndE-ValueType
SCOP:d1bkds_ 48 165 6e-22 SMART
Blast:RasGEFN 66 182 2e-57 BLAST
low complexity region 263 282 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (48/48)
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,589,127 Y123H probably damaging Het
Adamts14 T C 10: 61,202,887 E945G probably damaging Het
Adgrl3 T C 5: 81,724,129 V958A probably benign Het
Adh6a T C 3: 138,325,218 I156T probably benign Het
Akt1 A G 12: 112,658,429 V201A possibly damaging Het
Als2cl C G 9: 110,886,416 A182G possibly damaging Het
Amn T A 12: 111,275,385 L295Q probably benign Het
Dbf4 A G 5: 8,398,664 probably benign Het
Depdc7 G A 2: 104,721,969 R498C probably benign Het
Eogt A T 6: 97,145,366 Y35* probably null Het
Epb41l1 T G 2: 156,522,230 S886R probably damaging Het
Fshr A T 17: 88,986,028 D407E probably damaging Het
Gngt1 C A 6: 3,994,262 D13E probably benign Het
Grxcr1 T C 5: 68,166,141 L254P possibly damaging Het
Itga11 A G 9: 62,744,045 D290G probably damaging Het
Klf16 A G 10: 80,576,885 S106P probably benign Het
Klk5 A G 7: 43,850,780 D264G possibly damaging Het
Lama2 C T 10: 27,101,373 V1937M possibly damaging Het
Lipi T A 16: 75,573,974 K118N probably benign Het
Manba G A 3: 135,511,812 V130I probably benign Het
Map2 A G 1: 66,414,005 S527G probably damaging Het
Masp1 C A 16: 23,452,531 V656L probably damaging Het
Mrpl10 A T 11: 97,047,435 N137I probably benign Het
Mtfmt C A 9: 65,452,187 N381K probably benign Het
Myo18b A T 5: 112,873,556 Y546* probably null Het
Nectin4 C T 1: 171,384,712 R293* probably null Het
Nudt3 A G 17: 27,580,802 S136P possibly damaging Het
Olfr1158 T C 2: 87,990,192 L27P probably damaging Het
Olfr1254 T C 2: 89,789,242 M37V probably benign Het
Olfr292 A C 7: 86,695,153 R232S probably benign Het
Olfr357 G A 2: 36,997,054 M81I probably damaging Het
Olfr652 A G 7: 104,564,859 M213V probably benign Het
Oxnad1 A G 14: 32,101,293 probably null Het
Parn A G 16: 13,607,249 probably null Het
Pcdha12 T C 18: 37,021,083 V285A possibly damaging Het
Pfkfb2 G C 1: 130,697,079 Q515E probably benign Het
Pjvk T C 2: 76,650,557 F40L probably benign Het
Pygo2 A G 3: 89,433,390 Y328C probably damaging Het
Rapgef5 A C 12: 117,718,230 K215Q probably damaging Het
Sephs1 T A 2: 4,889,010 probably null Het
Slc12a9 C A 5: 137,315,475 V741L probably benign Het
Tbx21 A T 11: 97,099,982 V290D possibly damaging Het
Tep1 C A 14: 50,841,255 G1514W probably damaging Het
Vmn2r16 T C 5: 109,339,207 M98T probably benign Het
Zfr A G 15: 12,150,369 N474S probably benign Het
Zpbp T C 11: 11,415,203 K215E possibly damaging Het
Other mutations in 1700123K08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:1700123K08Rik APN 5 138562489 missense probably benign 0.01
IGL02318:1700123K08Rik APN 5 138563576 missense probably damaging 1.00
IGL02451:1700123K08Rik APN 5 138563547 missense probably damaging 1.00
IGL03263:1700123K08Rik APN 5 138564237 missense probably damaging 0.98
P0016:1700123K08Rik UTSW 5 138562938 nonsense probably null
R0686:1700123K08Rik UTSW 5 138564537 missense possibly damaging 0.70
R2051:1700123K08Rik UTSW 5 138564185 missense probably damaging 1.00
R2055:1700123K08Rik UTSW 5 138562845 missense probably damaging 0.99
R2185:1700123K08Rik UTSW 5 138563567 missense probably damaging 1.00
R2761:1700123K08Rik UTSW 5 138564174 missense possibly damaging 0.72
R4233:1700123K08Rik UTSW 5 138564192 missense probably damaging 1.00
R5610:1700123K08Rik UTSW 5 138564141 critical splice donor site probably null
R7136:1700123K08Rik UTSW 5 138562348 missense probably damaging 0.98
R7365:1700123K08Rik UTSW 5 138562936 missense probably benign 0.34
R8130:1700123K08Rik UTSW 5 138563009 missense probably damaging 0.98
R8347:1700123K08Rik UTSW 5 138562891 missense probably benign 0.00
R8350:1700123K08Rik UTSW 5 138562926 missense probably benign 0.02
R8351:1700123K08Rik UTSW 5 138562926 missense probably benign 0.02
R8352:1700123K08Rik UTSW 5 138562926 missense probably benign 0.02
R8450:1700123K08Rik UTSW 5 138562926 missense probably benign 0.02
R8451:1700123K08Rik UTSW 5 138562926 missense probably benign 0.02
R8452:1700123K08Rik UTSW 5 138562926 missense probably benign 0.02
Z1176:1700123K08Rik UTSW 5 138563553 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACTCTGGAGAATACCCCGG -3'
(R):5'- GACCACTATGCTCATCTGCAGAC -3'

Sequencing Primer
(F):5'- TCTGGAGAATACCCCGGTGAAATC -3'
(R):5'- TATGCTCATCTGCAGACAGGCTG -3'
Posted On2021-01-18