Incidental Mutation 'R8475:Itga11'
ID657228
Institutional Source Beutler Lab
Gene Symbol Itga11
Ensembl Gene ENSMUSG00000032243
Gene Nameintegrin alpha 11
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R8475 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location62677826-62783982 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62744045 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 290 (D290G)
Ref Sequence ENSEMBL: ENSMUSP00000034774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034774]
Predicted Effect probably damaging
Transcript: ENSMUST00000034774
AA Change: D290G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034774
Gene: ENSMUSG00000032243
AA Change: D290G

DomainStartEndE-ValueType
Int_alpha 37 90 3.9e-7 SMART
VWA 162 350 2.74e-38 SMART
Int_alpha 421 472 2.19e-1 SMART
Int_alpha 476 532 3.75e-9 SMART
Int_alpha 538 593 1.39e-12 SMART
Int_alpha 600 654 1.08e0 SMART
transmembrane domain 1142 1164 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein contains an I domain, is expressed in muscle tissue, dimerizes with beta 1 integrin in vitro, and appears to bind collagen in this form. Therefore, the protein may be involved in attaching muscle tissue to the extracellular matrix. Alternative transcriptional splice variants have been found for this gene, but their biological validity is not determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption of this gene display dwarfism, increased mortality with age, and defective incisors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik G A 5: 138,562,926 T158M probably benign Het
4921507P07Rik A G 6: 50,589,127 Y123H probably damaging Het
Adamts14 T C 10: 61,202,887 E945G probably damaging Het
Adgrl3 T C 5: 81,724,129 V958A probably benign Het
Adh6a T C 3: 138,325,218 I156T probably benign Het
Akt1 A G 12: 112,658,429 V201A possibly damaging Het
Als2cl C G 9: 110,886,416 A182G possibly damaging Het
Amn T A 12: 111,275,385 L295Q probably benign Het
Dbf4 A G 5: 8,398,664 probably benign Het
Depdc7 G A 2: 104,721,969 R498C probably benign Het
Eogt A T 6: 97,145,366 Y35* probably null Het
Epb41l1 T G 2: 156,522,230 S886R probably damaging Het
Fshr A T 17: 88,986,028 D407E probably damaging Het
Gngt1 C A 6: 3,994,262 D13E probably benign Het
Grxcr1 T C 5: 68,166,141 L254P possibly damaging Het
Klf16 A G 10: 80,576,885 S106P probably benign Het
Klk5 A G 7: 43,850,780 D264G possibly damaging Het
Lama2 C T 10: 27,101,373 V1937M possibly damaging Het
Lipi T A 16: 75,573,974 K118N probably benign Het
Manba G A 3: 135,511,812 V130I probably benign Het
Map2 A G 1: 66,414,005 S527G probably damaging Het
Masp1 C A 16: 23,452,531 V656L probably damaging Het
Mrpl10 A T 11: 97,047,435 N137I probably benign Het
Mtfmt C A 9: 65,452,187 N381K probably benign Het
Myo18b A T 5: 112,873,556 Y546* probably null Het
Nectin4 C T 1: 171,384,712 R293* probably null Het
Nudt3 A G 17: 27,580,802 S136P possibly damaging Het
Olfr1158 T C 2: 87,990,192 L27P probably damaging Het
Olfr1254 T C 2: 89,789,242 M37V probably benign Het
Olfr292 A C 7: 86,695,153 R232S probably benign Het
Olfr357 G A 2: 36,997,054 M81I probably damaging Het
Olfr652 A G 7: 104,564,859 M213V probably benign Het
Oxnad1 A G 14: 32,101,293 probably null Het
Parn A G 16: 13,607,249 probably null Het
Pcdha12 T C 18: 37,021,083 V285A possibly damaging Het
Pfkfb2 G C 1: 130,697,079 Q515E probably benign Het
Pjvk T C 2: 76,650,557 F40L probably benign Het
Pygo2 A G 3: 89,433,390 Y328C probably damaging Het
Rapgef5 A C 12: 117,718,230 K215Q probably damaging Het
Sephs1 T A 2: 4,889,010 probably null Het
Slc12a9 C A 5: 137,315,475 V741L probably benign Het
Tbx21 A T 11: 97,099,982 V290D possibly damaging Het
Tep1 C A 14: 50,841,255 G1514W probably damaging Het
Vmn2r16 T C 5: 109,339,207 M98T probably benign Het
Zfr A G 15: 12,150,369 N474S probably benign Het
Zpbp T C 11: 11,415,203 K215E possibly damaging Het
Other mutations in Itga11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Itga11 APN 9 62769305 missense possibly damaging 0.58
IGL01108:Itga11 APN 9 62757621 missense probably benign
IGL01348:Itga11 APN 9 62744579 missense possibly damaging 0.83
IGL01739:Itga11 APN 9 62774117 missense probably benign 0.03
IGL01918:Itga11 APN 9 62772996 missense probably benign 0.05
IGL02237:Itga11 APN 9 62755775 critical splice donor site probably null
IGL02418:Itga11 APN 9 62744632 missense probably benign 0.30
IGL02451:Itga11 APN 9 62735353 missense probably damaging 1.00
sneezy UTSW 9 62732109 missense probably damaging 1.00
PIT4812001:Itga11 UTSW 9 62732193 missense probably damaging 1.00
R0013:Itga11 UTSW 9 62776613 missense possibly damaging 0.89
R0013:Itga11 UTSW 9 62776613 missense possibly damaging 0.89
R0032:Itga11 UTSW 9 62774095 missense probably benign 0.05
R0032:Itga11 UTSW 9 62774095 missense probably benign 0.05
R0101:Itga11 UTSW 9 62744486 missense probably damaging 1.00
R0114:Itga11 UTSW 9 62735293 missense probably damaging 1.00
R0114:Itga11 UTSW 9 62760302 missense possibly damaging 0.85
R0212:Itga11 UTSW 9 62745969 missense probably benign 0.22
R0310:Itga11 UTSW 9 62760346 missense probably damaging 1.00
R0455:Itga11 UTSW 9 62696961 missense probably damaging 1.00
R0558:Itga11 UTSW 9 62752288 missense probably benign 0.01
R0607:Itga11 UTSW 9 62774371 missense probably benign 0.00
R0924:Itga11 UTSW 9 62776674 missense probably benign 0.14
R1085:Itga11 UTSW 9 62677970 missense probably benign 0.03
R1477:Itga11 UTSW 9 62755211 missense probably benign
R1647:Itga11 UTSW 9 62760370 missense probably benign 0.01
R1831:Itga11 UTSW 9 62782018 missense probably damaging 1.00
R1880:Itga11 UTSW 9 62677949 missense probably benign 0.06
R1934:Itga11 UTSW 9 62744514 missense probably damaging 1.00
R2025:Itga11 UTSW 9 62762811 missense probably damaging 1.00
R2046:Itga11 UTSW 9 62727697 missense probably damaging 1.00
R2145:Itga11 UTSW 9 62732204 splice site probably benign
R2922:Itga11 UTSW 9 62768630 splice site probably benign
R3011:Itga11 UTSW 9 62696980 missense probably damaging 0.99
R3158:Itga11 UTSW 9 62769278 missense probably benign 0.02
R3809:Itga11 UTSW 9 62771382 missense probably benign
R3836:Itga11 UTSW 9 62769283 missense probably benign 0.00
R4051:Itga11 UTSW 9 62755651 nonsense probably null
R4190:Itga11 UTSW 9 62732109 missense probably damaging 1.00
R4510:Itga11 UTSW 9 62761588 missense probably damaging 0.96
R4511:Itga11 UTSW 9 62761588 missense probably damaging 0.96
R4678:Itga11 UTSW 9 62735357 missense probably damaging 0.98
R4706:Itga11 UTSW 9 62755296 missense possibly damaging 0.64
R4713:Itga11 UTSW 9 62765788 missense probably damaging 1.00
R4798:Itga11 UTSW 9 62776727 splice site probably null
R4909:Itga11 UTSW 9 62755299 missense probably damaging 1.00
R4915:Itga11 UTSW 9 62752248 nonsense probably null
R4957:Itga11 UTSW 9 62767648 missense probably benign 0.00
R4962:Itga11 UTSW 9 62761568 nonsense probably null
R5081:Itga11 UTSW 9 62755196 missense probably benign 0.13
R5265:Itga11 UTSW 9 62737412 missense probably benign 0.05
R5308:Itga11 UTSW 9 62755769 missense probably benign
R5398:Itga11 UTSW 9 62745923 missense probably benign 0.21
R5717:Itga11 UTSW 9 62752249 missense probably benign 0.26
R5885:Itga11 UTSW 9 62762850 missense probably damaging 0.99
R5996:Itga11 UTSW 9 62755673 missense probably benign 0.01
R6394:Itga11 UTSW 9 62735266 splice site probably null
R6751:Itga11 UTSW 9 62768584 missense probably benign 0.02
R7041:Itga11 UTSW 9 62752256 missense probably damaging 1.00
R7264:Itga11 UTSW 9 62745908 missense probably benign 0.02
R7509:Itga11 UTSW 9 62781940 missense probably benign
R7601:Itga11 UTSW 9 62696926 missense probably benign 0.18
R7615:Itga11 UTSW 9 62744018 missense probably benign 0.00
R8263:Itga11 UTSW 9 62696980 missense possibly damaging 0.86
R8285:Itga11 UTSW 9 62752258 missense probably damaging 1.00
R8419:Itga11 UTSW 9 62755178 missense possibly damaging 0.59
R8422:Itga11 UTSW 9 62767678 missense probably benign 0.00
R8469:Itga11 UTSW 9 62771398 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTAGCTGTTGGAGTGCCCAC -3'
(R):5'- CAACCTGTTGTTCGGAGGAAG -3'

Sequencing Primer
(F):5'- TGCCCCCTAGAGGAAGGAC -3'
(R):5'- GGAAGATGCCGTTTGAGCC -3'
Posted On2021-01-18