Incidental Mutation 'R8475:Masp1'
ID657243
Institutional Source Beutler Lab
Gene Symbol Masp1
Ensembl Gene ENSMUSG00000022887
Gene Namemannan-binding lectin serine peptidase 1
SynonymsCrarf
Accession Numbers

Genbank: NM_008555; MGI: 88492

Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R8475 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location23449417-23520815 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 23452531 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 656 (V656L)
Ref Sequence ENSEMBL: ENSMUSP00000087327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089883]
Predicted Effect probably damaging
Transcript: ENSMUST00000089883
AA Change: V656L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000087327
Gene: ENSMUSG00000022887
AA Change: V656L

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
CUB 23 143 2.96e-36 SMART
EGF_CA 144 187 1.46e-7 SMART
CUB 190 302 1.49e-41 SMART
CCP 306 367 4.41e-12 SMART
CCP 372 437 3.05e-6 SMART
Tryp_SPc 453 696 4.66e-84 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (48/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele display decreased survivor rate, reduced body weight, and impaired activation of the lectin and alternative complement pathways. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Gene trapped(1)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik G A 5: 138,562,926 T158M probably benign Het
4921507P07Rik A G 6: 50,589,127 Y123H probably damaging Het
Adamts14 T C 10: 61,202,887 E945G probably damaging Het
Adgrl3 T C 5: 81,724,129 V958A probably benign Het
Adh6a T C 3: 138,325,218 I156T probably benign Het
Akt1 A G 12: 112,658,429 V201A possibly damaging Het
Als2cl C G 9: 110,886,416 A182G possibly damaging Het
Amn T A 12: 111,275,385 L295Q probably benign Het
Dbf4 A G 5: 8,398,664 probably benign Het
Depdc7 G A 2: 104,721,969 R498C probably benign Het
Eogt A T 6: 97,145,366 Y35* probably null Het
Epb41l1 T G 2: 156,522,230 S886R probably damaging Het
Fshr A T 17: 88,986,028 D407E probably damaging Het
Gngt1 C A 6: 3,994,262 D13E probably benign Het
Grxcr1 T C 5: 68,166,141 L254P possibly damaging Het
Itga11 A G 9: 62,744,045 D290G probably damaging Het
Klf16 A G 10: 80,576,885 S106P probably benign Het
Klk5 A G 7: 43,850,780 D264G possibly damaging Het
Lama2 C T 10: 27,101,373 V1937M possibly damaging Het
Lipi T A 16: 75,573,974 K118N probably benign Het
Manba G A 3: 135,511,812 V130I probably benign Het
Map2 A G 1: 66,414,005 S527G probably damaging Het
Mrpl10 A T 11: 97,047,435 N137I probably benign Het
Mtfmt C A 9: 65,452,187 N381K probably benign Het
Myo18b A T 5: 112,873,556 Y546* probably null Het
Nectin4 C T 1: 171,384,712 R293* probably null Het
Nudt3 A G 17: 27,580,802 S136P possibly damaging Het
Olfr1158 T C 2: 87,990,192 L27P probably damaging Het
Olfr1254 T C 2: 89,789,242 M37V probably benign Het
Olfr292 A C 7: 86,695,153 R232S probably benign Het
Olfr357 G A 2: 36,997,054 M81I probably damaging Het
Olfr652 A G 7: 104,564,859 M213V probably benign Het
Oxnad1 A G 14: 32,101,293 probably null Het
Parn A G 16: 13,607,249 probably null Het
Pcdha12 T C 18: 37,021,083 V285A possibly damaging Het
Pfkfb2 G C 1: 130,697,079 Q515E probably benign Het
Pjvk T C 2: 76,650,557 F40L probably benign Het
Pygo2 A G 3: 89,433,390 Y328C probably damaging Het
Rapgef5 A C 12: 117,718,230 K215Q probably damaging Het
Sephs1 T A 2: 4,889,010 probably null Het
Slc12a9 C A 5: 137,315,475 V741L probably benign Het
Tbx21 A T 11: 97,099,982 V290D possibly damaging Het
Tep1 C A 14: 50,841,255 G1514W probably damaging Het
Vmn2r16 T C 5: 109,339,207 M98T probably benign Het
Zfr A G 15: 12,150,369 N474S probably benign Het
Zpbp T C 11: 11,415,203 K215E possibly damaging Het
Other mutations in Masp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Masp1 APN 16 23458091 missense possibly damaging 0.93
IGL00428:Masp1 APN 16 23476312 missense probably damaging 1.00
IGL00432:Masp1 APN 16 23513851 missense probably damaging 1.00
IGL02598:Masp1 APN 16 23459631 missense probably benign
IGL02718:Masp1 APN 16 23476293 missense probably damaging 1.00
IGL02947:Masp1 APN 16 23494726 missense probably damaging 0.99
A4554:Masp1 UTSW 16 23454940 splice site probably null
PIT1430001:Masp1 UTSW 16 23513944 missense probably damaging 1.00
R0103:Masp1 UTSW 16 23458018 missense probably damaging 1.00
R0505:Masp1 UTSW 16 23458138 missense probably benign
R0630:Masp1 UTSW 16 23452419 missense probably benign 0.01
R1146:Masp1 UTSW 16 23492115 missense probably damaging 1.00
R1146:Masp1 UTSW 16 23492115 missense probably damaging 1.00
R1339:Masp1 UTSW 16 23452467 missense probably damaging 1.00
R1521:Masp1 UTSW 16 23494637 missense probably damaging 1.00
R1588:Masp1 UTSW 16 23494654 missense probably damaging 1.00
R1961:Masp1 UTSW 16 23452932 missense probably damaging 1.00
R1986:Masp1 UTSW 16 23483461 missense probably benign 0.01
R2080:Masp1 UTSW 16 23491959 missense probably damaging 1.00
R2215:Masp1 UTSW 16 23452521 missense possibly damaging 0.92
R2216:Masp1 UTSW 16 23492055 missense probably benign 0.00
R2443:Masp1 UTSW 16 23476312 missense probably damaging 1.00
R4934:Masp1 UTSW 16 23465076 missense probably damaging 0.98
R5224:Masp1 UTSW 16 23494695 missense probably damaging 1.00
R5340:Masp1 UTSW 16 23458108 missense probably damaging 1.00
R5562:Masp1 UTSW 16 23465167 splice site probably null
R5663:Masp1 UTSW 16 23452938 missense possibly damaging 0.57
R5742:Masp1 UTSW 16 23454925 missense probably benign 0.01
R5763:Masp1 UTSW 16 23496247 missense probably damaging 1.00
R5898:Masp1 UTSW 16 23491927 missense probably damaging 0.99
R6901:Masp1 UTSW 16 23513834 missense probably damaging 0.99
R6987:Masp1 UTSW 16 23513915 missense probably damaging 1.00
R7069:Masp1 UTSW 16 23452455 missense probably benign 0.20
R7356:Masp1 UTSW 16 23470243 missense possibly damaging 0.50
R7512:Masp1 UTSW 16 23470124 missense probably damaging 1.00
R7539:Masp1 UTSW 16 23470378 missense possibly damaging 0.94
R7810:Masp1 UTSW 16 23476318 missense probably benign 0.01
R8026:Masp1 UTSW 16 23484406 missense probably damaging 1.00
R8391:Masp1 UTSW 16 23470378 missense possibly damaging 0.94
R8438:Masp1 UTSW 16 23470403 missense probably benign 0.38
R8870:Masp1 UTSW 16 23496132 missense probably damaging 1.00
X0065:Masp1 UTSW 16 23513969 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTGACCATACAGCAGGTG -3'
(R):5'- CTGAACCAGCCCTTTCTGAC -3'

Sequencing Primer
(F):5'- ACCATACAGCAGGTGTTGGGC -3'
(R):5'- CTGACCTATAGAGCACAGCTTTGG -3'
Posted On2021-01-18