Incidental Mutation 'R8477:Gm19965'
ID 657282
Institutional Source Beutler Lab
Gene Symbol Gm19965
Ensembl Gene ENSMUSG00000094429
Gene Name predicted gene, 19965
Synonyms
MMRRC Submission 067921-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.089) question?
Stock # R8477 (G1)
Quality Score 195.009
Status Validated
Chromosome 1
Chromosomal Location 116730713-116751140 bp(+) (GRCm39)
Type of Mutation start gained
DNA Base Change (assembly) A to C at 116730854 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179777]
AlphaFold J3QNY8
Predicted Effect probably benign
Transcript: ENSMUST00000179777
SMART Domains Protein: ENSMUSP00000137019
Gene: ENSMUSG00000094429

DomainStartEndE-ValueType
KRAB 8 68 1.5e-36 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 78,924,174 (GRCm39) S94L probably benign Het
Ackr1 C T 1: 173,159,755 (GRCm39) G255R probably damaging Het
Aldh1l2 G A 10: 83,337,785 (GRCm39) T560I probably damaging Het
Arhgef25 A T 10: 127,020,266 (GRCm39) F384I probably damaging Het
Bptf T A 11: 106,943,679 (GRCm39) Q2671L probably damaging Het
Ccdc159 A G 9: 21,844,223 (GRCm39) E95G probably damaging Het
Cenpf A T 1: 189,385,385 (GRCm39) H2298Q probably benign Het
Chn2 G T 6: 54,246,467 (GRCm39) probably null Het
Csnk1g1 T C 9: 65,909,555 (GRCm39) L224P probably damaging Het
Cyp2c54 T A 19: 40,058,708 (GRCm39) K241N probably benign Het
Cyp2c55 G T 19: 38,999,485 (GRCm39) V64L probably damaging Het
Dlgap1 A C 17: 70,823,967 (GRCm39) Q317H probably damaging Het
Dnaja3 A G 16: 4,505,212 (GRCm39) D108G probably null Het
Dpagt1 G T 9: 44,243,390 (GRCm39) probably null Het
Dzip1 T C 14: 119,138,958 (GRCm39) R424G possibly damaging Het
Ero1b A G 13: 12,616,672 (GRCm39) K367R probably benign Het
Evi2 T C 11: 79,406,891 (GRCm39) Y228C probably benign Het
Exosc10 A T 4: 148,649,847 (GRCm39) I426L possibly damaging Het
Gba2 C T 4: 43,569,944 (GRCm39) R423Q probably damaging Het
Gpr165 C A X: 95,757,623 (GRCm39) D7E probably benign Het
Gvin2 T C 7: 105,548,133 (GRCm39) K1640E possibly damaging Het
Hc A T 2: 34,879,182 (GRCm39) C1557S probably damaging Het
Hfm1 C T 5: 107,029,684 (GRCm39) S799N probably benign Het
Hibadh A T 6: 52,617,185 (GRCm39) W17R probably benign Het
Hivep1 A T 13: 42,337,696 (GRCm39) T2592S probably benign Het
Ighv8-5 G A 12: 115,031,200 (GRCm39) T113I probably benign Het
Il2rb A T 15: 78,370,006 (GRCm39) V211D probably damaging Het
Itgal A G 7: 126,900,105 (GRCm39) Y121C probably damaging Het
Kirrel1 T C 3: 86,992,138 (GRCm39) T597A possibly damaging Het
Lats1 A G 10: 7,581,279 (GRCm39) E688G probably damaging Het
Lbr C T 1: 181,644,539 (GRCm39) A589T possibly damaging Het
Limch1 G A 5: 67,131,908 (GRCm39) V133I probably benign Het
Mast2 C T 4: 116,164,407 (GRCm39) A1670T probably benign Het
Mtcl1 A T 17: 66,684,942 (GRCm39) L949Q probably benign Het
Nlrp4a T C 7: 26,159,219 (GRCm39) V833A probably benign Het
Or12k5 T C 2: 36,895,060 (GRCm39) T189A probably benign Het
Or8g28 A T 9: 39,169,099 (GRCm39) Y290N probably damaging Het
Osgep C A 14: 51,155,334 (GRCm39) A75S probably damaging Het
Pank1 C A 19: 34,856,055 (GRCm39) R141L probably benign Het
Pcdhb20 T A 18: 37,638,307 (GRCm39) S278T probably benign Het
Pcdhgb8 C A 18: 37,896,365 (GRCm39) F478L probably benign Het
Peg10 C CTCT 6: 4,756,453 (GRCm39) probably benign Het
Polr2a G A 11: 69,626,312 (GRCm39) P1613S probably benign Het
Pramel55 A C 5: 95,949,567 (GRCm39) M105L probably benign Het
Prom2 A C 2: 127,381,124 (GRCm39) S251A probably benign Het
R3hdm2 A G 10: 127,320,029 (GRCm39) H546R probably damaging Het
Reck G T 4: 43,891,011 (GRCm39) V50L probably benign Het
Rerg T C 6: 137,033,184 (GRCm39) T164A probably benign Het
Rho T A 6: 115,912,346 (GRCm39) probably null Het
Ric1 A G 19: 29,575,183 (GRCm39) T959A probably damaging Het
Slc28a3 T A 13: 58,724,609 (GRCm39) N215I possibly damaging Het
Slc2a5 G A 4: 150,210,119 (GRCm39) V35I probably benign Het
Srpk2 A T 5: 23,718,986 (GRCm39) S610T probably benign Het
Tasor2 A G 13: 3,625,079 (GRCm39) F1624L probably benign Het
Tmem147 T A 7: 30,427,656 (GRCm39) M86L probably benign Het
Trhde A G 10: 114,636,622 (GRCm39) V195A probably benign Het
Trio T C 15: 27,774,038 (GRCm39) S112G possibly damaging Het
U2af2 T C 7: 5,078,693 (GRCm39) V424A probably benign Het
Vmn2r27 T C 6: 124,201,200 (GRCm39) I252M probably benign Het
Wasf2 A G 4: 132,912,412 (GRCm39) E88G unknown Het
Zfp37 A G 4: 62,110,240 (GRCm39) C275R probably damaging Het
Zfp532 A T 18: 65,757,137 (GRCm39) I357F probably damaging Het
Other mutations in Gm19965
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0993:Gm19965 UTSW 1 116,749,555 (GRCm39) missense probably benign 0.04
R1016:Gm19965 UTSW 1 116,749,031 (GRCm39) nonsense probably null
R1173:Gm19965 UTSW 1 116,748,550 (GRCm39) splice site probably benign
R1175:Gm19965 UTSW 1 116,748,550 (GRCm39) splice site probably benign
R1335:Gm19965 UTSW 1 116,732,349 (GRCm39) missense possibly damaging 0.79
R1773:Gm19965 UTSW 1 116,748,989 (GRCm39) nonsense probably null
R1802:Gm19965 UTSW 1 116,748,633 (GRCm39) nonsense probably null
R2884:Gm19965 UTSW 1 116,749,313 (GRCm39) missense probably benign 0.14
R3435:Gm19965 UTSW 1 116,749,353 (GRCm39) missense possibly damaging 0.78
R4072:Gm19965 UTSW 1 116,748,801 (GRCm39) missense probably benign 0.17
R4585:Gm19965 UTSW 1 116,749,508 (GRCm39) missense probably benign 0.00
R4801:Gm19965 UTSW 1 116,749,626 (GRCm39) missense probably benign
R4802:Gm19965 UTSW 1 116,749,626 (GRCm39) missense probably benign
R5328:Gm19965 UTSW 1 116,749,148 (GRCm39) missense possibly damaging 0.78
R5856:Gm19965 UTSW 1 116,749,579 (GRCm39) missense probably benign
R5960:Gm19965 UTSW 1 116,749,201 (GRCm39) missense possibly damaging 0.67
R6185:Gm19965 UTSW 1 116,749,003 (GRCm39) missense possibly damaging 0.61
R6297:Gm19965 UTSW 1 116,750,410 (GRCm39) missense possibly damaging 0.82
R6374:Gm19965 UTSW 1 116,750,021 (GRCm39) missense probably benign 0.06
R6811:Gm19965 UTSW 1 116,731,809 (GRCm39) missense probably damaging 1.00
R6860:Gm19965 UTSW 1 116,748,609 (GRCm39) missense probably benign 0.19
R7076:Gm19965 UTSW 1 116,749,005 (GRCm39) missense
R7162:Gm19965 UTSW 1 116,750,095 (GRCm39) missense unknown
R7290:Gm19965 UTSW 1 116,748,921 (GRCm39) missense
R7473:Gm19965 UTSW 1 116,749,602 (GRCm39) missense unknown
R7643:Gm19965 UTSW 1 116,749,959 (GRCm39) missense unknown
R7919:Gm19965 UTSW 1 116,749,850 (GRCm39) nonsense probably null
R8187:Gm19965 UTSW 1 116,749,532 (GRCm39) nonsense probably null
R8306:Gm19965 UTSW 1 116,749,515 (GRCm39) missense
R8751:Gm19965 UTSW 1 116,749,867 (GRCm39) missense unknown
R8876:Gm19965 UTSW 1 116,749,776 (GRCm39) missense unknown
R9151:Gm19965 UTSW 1 116,748,942 (GRCm39) missense
R9389:Gm19965 UTSW 1 116,749,566 (GRCm39) missense
R9444:Gm19965 UTSW 1 116,732,393 (GRCm39) missense
R9696:Gm19965 UTSW 1 116,749,210 (GRCm39) missense
R9696:Gm19965 UTSW 1 116,730,838 (GRCm39) start gained probably benign
Z1088:Gm19965 UTSW 1 116,732,330 (GRCm39) missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GGCAACTATATGGAATTGGTTACG -3'
(R):5'- TTTAGCTCACCAGTGACAGAAC -3'

Sequencing Primer
(F):5'- ACGAAAATCTTTTGTTTCTTCTGC -3'
(R):5'- GCTCACCAGTGACAGAACATTTAAAG -3'
Posted On 2021-01-18