Incidental Mutation 'R8477:Ackr1'
ID657284
Institutional Source Beutler Lab
Gene Symbol Ackr1
Ensembl Gene ENSMUSG00000037872
Gene Nameatypical chemokine receptor 1 (Duffy blood group)
SynonymsDarc, ESTM35, Dfy, FY, CCBP1, CD234
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8477 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location173331886-173333750 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 173332188 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 255 (G255R)
Ref Sequence ENSEMBL: ENSMUSP00000045134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005470] [ENSMUST00000038227] [ENSMUST00000111220] [ENSMUST00000194046]
Predicted Effect probably benign
Transcript: ENSMUST00000005470
SMART Domains Protein: ENSMUSP00000005470
Gene: ENSMUSG00000005338

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 67 159 1.43e-8 SMART
IG 169 262 6.31e-1 SMART
IGc2 277 338 3.91e-6 SMART
low complexity region 351 359 N/A INTRINSIC
4.1m 383 401 9.24e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000038227
AA Change: G255R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045134
Gene: ENSMUSG00000037872
AA Change: G255R

DomainStartEndE-ValueType
SCOP:d1l9ha_ 26 317 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111220
SMART Domains Protein: ENSMUSP00000106851
Gene: ENSMUSG00000005338

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
IG 33 125 1.43e-8 SMART
IG 135 228 6.31e-1 SMART
IGc2 243 304 3.91e-6 SMART
low complexity region 317 325 N/A INTRINSIC
4.1m 349 367 9.24e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194046
SMART Domains Protein: ENSMUSP00000141765
Gene: ENSMUSG00000037872

DomainStartEndE-ValueType
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycosylated membrane protein and a non-specific receptor for several chemokines. The encoded protein is the receptor for the human malarial parasites Plasmodium vivax and Plasmodium knowlesi. Polymorphisms in this gene are the basis of the Duffy blood group system. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are healthy, but erythrocytes lack CXC and CC chemokine-binding activity, such that when challenged with LPS result in increased inflammatory infiltrates in lung and liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 79,088,340 S94L probably benign Het
Aldh1l2 G A 10: 83,501,921 T560I probably damaging Het
Arhgef25 A T 10: 127,184,397 F384I probably damaging Het
Bptf T A 11: 107,052,853 Q2671L probably damaging Het
Ccdc159 A G 9: 21,932,927 E95G probably damaging Het
Cenpf A T 1: 189,653,188 H2298Q probably benign Het
Chn2 G T 6: 54,269,482 probably null Het
Csnk1g1 T C 9: 66,002,273 L224P probably damaging Het
Cyp2c54 T A 19: 40,070,264 K241N probably benign Het
Cyp2c55 G T 19: 39,011,041 V64L probably damaging Het
Dlgap1 A C 17: 70,516,972 Q317H probably damaging Het
Dnaja3 A G 16: 4,687,348 D108G probably null Het
Dpagt1 G T 9: 44,332,093 probably null Het
Dzip1 T C 14: 118,901,546 R424G possibly damaging Het
E330014E10Rik A C 5: 95,801,708 M105L probably benign Het
Ero1lb A G 13: 12,601,783 K367R probably benign Het
Evi2 T C 11: 79,516,065 Y228C probably benign Het
Exosc10 A T 4: 148,565,390 I426L possibly damaging Het
Fam208b A G 13: 3,575,079 F1624L probably benign Het
Gba2 C T 4: 43,569,944 R423Q probably damaging Het
Gm19965 A C 1: 116,803,124 probably benign Het
Gm4070 T C 7: 105,898,926 K1640E possibly damaging Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Hc A T 2: 34,989,170 C1557S probably damaging Het
Hfm1 C T 5: 106,881,818 S799N probably benign Het
Hibadh A T 6: 52,640,200 W17R probably benign Het
Hivep1 A T 13: 42,184,220 T2592S probably benign Het
Ighv8-5 G A 12: 115,067,580 T113I probably benign Het
Il2rb A T 15: 78,485,806 V211D probably damaging Het
Itgal A G 7: 127,300,933 Y121C probably damaging Het
Kirrel T C 3: 87,084,831 T597A possibly damaging Het
Lats1 A G 10: 7,705,515 E688G probably damaging Het
Lbr C T 1: 181,816,974 A589T possibly damaging Het
Limch1 G A 5: 66,974,565 V133I probably benign Het
Mast2 C T 4: 116,307,210 A1670T probably benign Het
Mtcl1 A T 17: 66,377,947 L949Q probably benign Het
Nlrp4a T C 7: 26,459,794 V833A probably benign Het
Olfr358 T C 2: 37,005,048 T189A probably benign Het
Olfr945 A T 9: 39,257,803 Y290N probably damaging Het
Osgep C A 14: 50,917,877 A75S probably damaging Het
Pank1 C A 19: 34,878,655 R141L probably benign Het
Pcdhb20 T A 18: 37,505,254 S278T probably benign Het
Pcdhgb8 C A 18: 37,763,312 F478L probably benign Het
Peg10 C CTCT 6: 4,756,453 probably benign Het
Polr2a G A 11: 69,735,486 P1613S probably benign Het
Prom2 A C 2: 127,539,204 S251A probably benign Het
R3hdm2 A G 10: 127,484,160 H546R probably damaging Het
Reck G T 4: 43,891,011 V50L probably benign Het
Rerg T C 6: 137,056,186 T164A probably benign Het
Rho T A 6: 115,935,385 probably null Het
Ric1 A G 19: 29,597,783 T959A probably damaging Het
Slc28a3 T A 13: 58,576,795 N215I possibly damaging Het
Slc2a5 G A 4: 150,125,662 V35I probably benign Het
Srpk2 A T 5: 23,513,988 S610T probably benign Het
Tmem147 T A 7: 30,728,231 M86L probably benign Het
Trhde A G 10: 114,800,717 V195A probably benign Het
Trio T C 15: 27,773,952 S112G possibly damaging Het
U2af2 T C 7: 5,075,694 V424A probably benign Het
Vmn2r27 T C 6: 124,224,241 I252M probably benign Het
Wasf2 A G 4: 133,185,101 E88G unknown Het
Zfp37 A G 4: 62,192,003 C275R probably damaging Het
Zfp532 A T 18: 65,624,066 I357F probably damaging Het
Other mutations in Ackr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02093:Ackr1 APN 1 173332829 missense probably benign 0.23
R0479:Ackr1 UTSW 1 173332145 missense probably benign 0.02
R1664:Ackr1 UTSW 1 173332866 missense probably benign 0.36
R1713:Ackr1 UTSW 1 173332349 missense probably benign 0.38
R2273:Ackr1 UTSW 1 173332485 missense probably benign 0.17
R2274:Ackr1 UTSW 1 173332485 missense probably benign 0.17
R2275:Ackr1 UTSW 1 173332485 missense probably benign 0.17
R4469:Ackr1 UTSW 1 173332545 splice site probably null
R5871:Ackr1 UTSW 1 173332073 missense probably damaging 0.99
R6523:Ackr1 UTSW 1 173332553 critical splice donor site probably null
R7062:Ackr1 UTSW 1 173332115 missense possibly damaging 0.68
R7751:Ackr1 UTSW 1 173332212 missense probably damaging 0.96
R8234:Ackr1 UTSW 1 173332015 missense probably benign 0.12
R8697:Ackr1 UTSW 1 173332208 missense probably damaging 0.96
R8738:Ackr1 UTSW 1 173332385 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGCATCCATTTGAGAAGCCTG -3'
(R):5'- ATCCTCCAGAGACATGGAAGC -3'

Sequencing Primer
(F):5'- GCATCCATTTGAGAAGCCTGTCTTG -3'
(R):5'- CATGGAAGCTTTGAAGTACATGC -3'
Posted On2021-01-18