Incidental Mutation 'R8477:Hc'
ID657287
Institutional Source Beutler Lab
Gene Symbol Hc
Ensembl Gene ENSMUSG00000026874
Gene Namehemolytic complement
SynonymsHe, C5, C5a
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.700) question?
Stock #R8477 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location34983331-35061438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34989170 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 1557 (C1557S)
Ref Sequence ENSEMBL: ENSMUSP00000028233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028233]
PDB Structure Crystal structure of the mouse C5a anaphylatoxin [X-RAY DIFFRACTION]
Crystal structure of the mouse C5a-desArg anaphylatoxin [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028233
AA Change: C1557S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028233
Gene: ENSMUSG00000026874
AA Change: C1557S

DomainStartEndE-ValueType
Pfam:A2M_N 125 219 1.8e-15 PFAM
A2M_N_2 465 612 9.83e-34 SMART
ANATO 702 736 4.73e-12 SMART
A2M 776 863 2.44e-29 SMART
Pfam:A2M_comp 1055 1306 2.3e-68 PFAM
A2M_recep 1423 1513 7.29e-28 SMART
C345C 1553 1665 1.51e-35 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: This gene encodes a component of the complement system, a part of the innate immune system that plays an important role in inflammation, host homeostasis, and host defense against pathogens. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the C5 alpha chain, C5 beta chain, C5a anaphylatoxin and C5b. The C5 protein is comprised of the alpha and beta chains, which are linked by a disulfide bridge. Cleavage of the alpha chain by a convertase enzyme results in the formation of the C5a anaphylatoxin, which possesses potent spasmogenic and chemotactic activity, and the C5b macromolecular cleavage product, a subunit of the membrane attack complex (MAC). Mice with a homozygous mutation in this gene exhibit impaired bone fracture healing and an enhanced inflammatory response in an allergic lung disease model. [provided by RefSeq, Nov 2015]
PHENOTYPE: Macrophage from mice homozygous for disruptions of this gene do not secrete complement C5.

The 2 bp deletion found in A/J and AKR/J strains is associated with susceptibility to allergen-induced bronchial hyperresponsiveness and is a candidate for QTL Abhr2.

[provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 79,088,340 S94L probably benign Het
Ackr1 C T 1: 173,332,188 G255R probably damaging Het
Aldh1l2 G A 10: 83,501,921 T560I probably damaging Het
Arhgef25 A T 10: 127,184,397 F384I probably damaging Het
Bptf T A 11: 107,052,853 Q2671L probably damaging Het
Ccdc159 A G 9: 21,932,927 E95G probably damaging Het
Cenpf A T 1: 189,653,188 H2298Q probably benign Het
Chn2 G T 6: 54,269,482 probably null Het
Csnk1g1 T C 9: 66,002,273 L224P probably damaging Het
Cyp2c54 T A 19: 40,070,264 K241N probably benign Het
Cyp2c55 G T 19: 39,011,041 V64L probably damaging Het
Dlgap1 A C 17: 70,516,972 Q317H probably damaging Het
Dnaja3 A G 16: 4,687,348 D108G probably null Het
Dpagt1 G T 9: 44,332,093 probably null Het
Dzip1 T C 14: 118,901,546 R424G possibly damaging Het
E330014E10Rik A C 5: 95,801,708 M105L probably benign Het
Ero1lb A G 13: 12,601,783 K367R probably benign Het
Evi2 T C 11: 79,516,065 Y228C probably benign Het
Exosc10 A T 4: 148,565,390 I426L possibly damaging Het
Fam208b A G 13: 3,575,079 F1624L probably benign Het
Gba2 C T 4: 43,569,944 R423Q probably damaging Het
Gm19965 A C 1: 116,803,124 probably benign Het
Gm4070 T C 7: 105,898,926 K1640E possibly damaging Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Hfm1 C T 5: 106,881,818 S799N probably benign Het
Hibadh A T 6: 52,640,200 W17R probably benign Het
Hivep1 A T 13: 42,184,220 T2592S probably benign Het
Ighv8-5 G A 12: 115,067,580 T113I probably benign Het
Il2rb A T 15: 78,485,806 V211D probably damaging Het
Itgal A G 7: 127,300,933 Y121C probably damaging Het
Kirrel T C 3: 87,084,831 T597A possibly damaging Het
Lats1 A G 10: 7,705,515 E688G probably damaging Het
Lbr C T 1: 181,816,974 A589T possibly damaging Het
Limch1 G A 5: 66,974,565 V133I probably benign Het
Mast2 C T 4: 116,307,210 A1670T probably benign Het
Mtcl1 A T 17: 66,377,947 L949Q probably benign Het
Nlrp4a T C 7: 26,459,794 V833A probably benign Het
Olfr358 T C 2: 37,005,048 T189A probably benign Het
Olfr945 A T 9: 39,257,803 Y290N probably damaging Het
Osgep C A 14: 50,917,877 A75S probably damaging Het
Pank1 C A 19: 34,878,655 R141L probably benign Het
Pcdhb20 T A 18: 37,505,254 S278T probably benign Het
Pcdhgb8 C A 18: 37,763,312 F478L probably benign Het
Peg10 C CTCT 6: 4,756,453 probably benign Het
Polr2a G A 11: 69,735,486 P1613S probably benign Het
Prom2 A C 2: 127,539,204 S251A probably benign Het
R3hdm2 A G 10: 127,484,160 H546R probably damaging Het
Reck G T 4: 43,891,011 V50L probably benign Het
Rerg T C 6: 137,056,186 T164A probably benign Het
Rho T A 6: 115,935,385 probably null Het
Ric1 A G 19: 29,597,783 T959A probably damaging Het
Slc28a3 T A 13: 58,576,795 N215I possibly damaging Het
Slc2a5 G A 4: 150,125,662 V35I probably benign Het
Srpk2 A T 5: 23,513,988 S610T probably benign Het
Tmem147 T A 7: 30,728,231 M86L probably benign Het
Trhde A G 10: 114,800,717 V195A probably benign Het
Trio T C 15: 27,773,952 S112G possibly damaging Het
U2af2 T C 7: 5,075,694 V424A probably benign Het
Vmn2r27 T C 6: 124,224,241 I252M probably benign Het
Wasf2 A G 4: 133,185,101 E88G unknown Het
Zfp37 A G 4: 62,192,003 C275R probably damaging Het
Zfp532 A T 18: 65,624,066 I357F probably damaging Het
Other mutations in Hc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Hc APN 2 34991629 missense probably benign 0.00
IGL00922:Hc APN 2 34991668 missense probably damaging 1.00
IGL01523:Hc APN 2 35039238 missense probably benign 0.04
IGL01746:Hc APN 2 35057326 missense probably damaging 0.98
IGL01793:Hc APN 2 35028190 missense probably damaging 1.00
IGL01972:Hc APN 2 34983772 missense probably damaging 1.00
IGL02037:Hc APN 2 35013519 missense probably benign 0.16
IGL02048:Hc APN 2 34996027 missense probably benign 0.00
IGL02227:Hc APN 2 35009911 intron probably benign
IGL02230:Hc APN 2 35013670 missense probably benign
IGL02254:Hc APN 2 34984824 missense probably damaging 1.00
IGL02363:Hc APN 2 35000835 missense probably benign
IGL02650:Hc APN 2 35000874 missense possibly damaging 0.49
IGL03053:Hc APN 2 35024198 missense probably benign 0.07
IGL03168:Hc APN 2 35024198 missense probably benign 0.07
IGL03341:Hc APN 2 35003377 missense probably damaging 0.98
PIT4142001:Hc UTSW 2 35031821 splice site probably benign
PIT4378001:Hc UTSW 2 35031864 missense probably benign 0.13
PIT4508001:Hc UTSW 2 34984804 missense probably damaging 0.96
PIT4812001:Hc UTSW 2 35029452 missense probably benign 0.16
R0025:Hc UTSW 2 34986292 missense probably damaging 1.00
R0053:Hc UTSW 2 35057275 missense probably benign 0.32
R0197:Hc UTSW 2 34984750 missense probably damaging 1.00
R0218:Hc UTSW 2 35028074 missense probably damaging 1.00
R0242:Hc UTSW 2 35036154 splice site probably benign
R0496:Hc UTSW 2 35013571 missense probably damaging 1.00
R1205:Hc UTSW 2 35003524 missense possibly damaging 0.50
R1468:Hc UTSW 2 34983807 nonsense probably null
R1468:Hc UTSW 2 34983807 nonsense probably null
R1574:Hc UTSW 2 35000765 intron probably benign
R1610:Hc UTSW 2 35006161 missense probably benign 0.44
R1640:Hc UTSW 2 35057324 nonsense probably null
R1887:Hc UTSW 2 35034611 missense probably benign
R1920:Hc UTSW 2 35029395 splice site probably benign
R2018:Hc UTSW 2 35013528 missense probably damaging 1.00
R2019:Hc UTSW 2 35013528 missense probably damaging 1.00
R2151:Hc UTSW 2 34991103 intron probably benign
R2366:Hc UTSW 2 35013636 missense probably benign
R4093:Hc UTSW 2 34983807 nonsense probably null
R4288:Hc UTSW 2 35030402 missense probably damaging 0.98
R4501:Hc UTSW 2 34997476 splice site probably null
R4502:Hc UTSW 2 35006252 missense probably benign 0.00
R4508:Hc UTSW 2 35013065 missense possibly damaging 0.94
R4583:Hc UTSW 2 35028177 missense probably benign 0.00
R4686:Hc UTSW 2 35039248 missense possibly damaging 0.49
R4776:Hc UTSW 2 35039734 missense probably benign 0.12
R4846:Hc UTSW 2 35019670 missense probably benign 0.00
R5032:Hc UTSW 2 35013532 missense probably benign 0.07
R5089:Hc UTSW 2 35024890 missense probably benign 0.01
R5289:Hc UTSW 2 34996014 critical splice donor site probably null
R5347:Hc UTSW 2 35037624 missense probably benign 0.04
R5356:Hc UTSW 2 34994995 missense probably benign 0.00
R5379:Hc UTSW 2 34991065 missense probably damaging 1.00
R5403:Hc UTSW 2 35057434 missense probably damaging 1.00
R5418:Hc UTSW 2 35008183 critical splice donor site probably null
R5450:Hc UTSW 2 35013038 missense possibly damaging 0.67
R5494:Hc UTSW 2 35003539 splice site probably null
R5713:Hc UTSW 2 35013531 missense probably damaging 0.99
R5898:Hc UTSW 2 34997437 missense probably benign 0.06
R5925:Hc UTSW 2 35030450 missense possibly damaging 0.92
R5942:Hc UTSW 2 35028125 nonsense probably null
R5991:Hc UTSW 2 35006105 missense possibly damaging 0.91
R6036:Hc UTSW 2 35039684 missense probably benign 0.00
R6036:Hc UTSW 2 35039684 missense probably benign 0.00
R6115:Hc UTSW 2 35013038 missense probably damaging 1.00
R6234:Hc UTSW 2 35028046 missense probably benign
R6264:Hc UTSW 2 35006273 critical splice acceptor site probably null
R6313:Hc UTSW 2 34989839 splice site probably null
R6525:Hc UTSW 2 34991224 missense probably benign 0.06
R6577:Hc UTSW 2 35032126 missense probably benign 0.00
R6601:Hc UTSW 2 35045894 missense probably benign 0.03
R6916:Hc UTSW 2 35010032 nonsense probably null
R7108:Hc UTSW 2 35039694 missense probably benign 0.03
R7143:Hc UTSW 2 35050438 missense probably benign 0.00
R7388:Hc UTSW 2 34984847 splice site probably null
R7468:Hc UTSW 2 35028051 missense probably benign 0.00
R7504:Hc UTSW 2 35061319 missense not run
R7521:Hc UTSW 2 35045332 missense possibly damaging 0.80
R7582:Hc UTSW 2 34991266 missense possibly damaging 0.70
R7596:Hc UTSW 2 35000847 missense probably damaging 0.96
R7599:Hc UTSW 2 35050419 missense probably damaging 1.00
R7692:Hc UTSW 2 35024149 missense probably damaging 1.00
R7853:Hc UTSW 2 35010033 missense probably damaging 1.00
R7877:Hc UTSW 2 34997399 nonsense probably null
R8329:Hc UTSW 2 35012898 splice site probably null
R8375:Hc UTSW 2 34983719 missense probably benign 0.32
R8810:Hc UTSW 2 35019523 missense probably benign 0.06
X0066:Hc UTSW 2 34983711 missense probably damaging 1.00
Z1088:Hc UTSW 2 35008249 missense possibly damaging 0.94
Z1088:Hc UTSW 2 35029470 missense probably benign 0.02
Z1176:Hc UTSW 2 35006273 critical splice acceptor site probably null
Z1177:Hc UTSW 2 35013610 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGGAATAAGTGTAGTACCTCTACTC -3'
(R):5'- AAGACTTTGGTCAGCTGGGTTC -3'

Sequencing Primer
(F):5'- GTGTAGTACCTCTACTCAAACAAGGG -3'
(R):5'- CAGGTCTTAGGAATAATGAAGTTCC -3'
Posted On2021-01-18