Incidental Mutation 'R8477:Olfr358'
ID657288
Institutional Source Beutler Lab
Gene Symbol Olfr358
Ensembl Gene ENSMUSG00000075379
Gene Nameolfactory receptor 358
SynonymsMOR159-4, GA_x6K02T2NLDC-33697309-33696317
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R8477 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location37002163-37009335 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37005048 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 189 (T189A)
Ref Sequence ENSEMBL: ENSMUSP00000150781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100146] [ENSMUST00000213218] [ENSMUST00000216437]
Predicted Effect probably benign
Transcript: ENSMUST00000100146
AA Change: T189A

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097724
Gene: ENSMUSG00000075379
AA Change: T189A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 6.4e-49 PFAM
Pfam:7TM_GPCR_Srsx 35 214 4.7e-7 PFAM
Pfam:7tm_1 41 289 2.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213218
Predicted Effect probably benign
Transcript: ENSMUST00000216437
AA Change: T189A

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 79,088,340 S94L probably benign Het
Ackr1 C T 1: 173,332,188 G255R probably damaging Het
Aldh1l2 G A 10: 83,501,921 T560I probably damaging Het
Arhgef25 A T 10: 127,184,397 F384I probably damaging Het
Bptf T A 11: 107,052,853 Q2671L probably damaging Het
Ccdc159 A G 9: 21,932,927 E95G probably damaging Het
Cenpf A T 1: 189,653,188 H2298Q probably benign Het
Chn2 G T 6: 54,269,482 probably null Het
Csnk1g1 T C 9: 66,002,273 L224P probably damaging Het
Cyp2c54 T A 19: 40,070,264 K241N probably benign Het
Cyp2c55 G T 19: 39,011,041 V64L probably damaging Het
Dlgap1 A C 17: 70,516,972 Q317H probably damaging Het
Dnaja3 A G 16: 4,687,348 D108G probably null Het
Dpagt1 G T 9: 44,332,093 probably null Het
Dzip1 T C 14: 118,901,546 R424G possibly damaging Het
E330014E10Rik A C 5: 95,801,708 M105L probably benign Het
Ero1lb A G 13: 12,601,783 K367R probably benign Het
Evi2 T C 11: 79,516,065 Y228C probably benign Het
Exosc10 A T 4: 148,565,390 I426L possibly damaging Het
Fam208b A G 13: 3,575,079 F1624L probably benign Het
Gba2 C T 4: 43,569,944 R423Q probably damaging Het
Gm19965 A C 1: 116,803,124 probably benign Het
Gm4070 T C 7: 105,898,926 K1640E possibly damaging Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Hc A T 2: 34,989,170 C1557S probably damaging Het
Hfm1 C T 5: 106,881,818 S799N probably benign Het
Hibadh A T 6: 52,640,200 W17R probably benign Het
Hivep1 A T 13: 42,184,220 T2592S probably benign Het
Ighv8-5 G A 12: 115,067,580 T113I probably benign Het
Il2rb A T 15: 78,485,806 V211D probably damaging Het
Itgal A G 7: 127,300,933 Y121C probably damaging Het
Kirrel T C 3: 87,084,831 T597A possibly damaging Het
Lats1 A G 10: 7,705,515 E688G probably damaging Het
Lbr C T 1: 181,816,974 A589T possibly damaging Het
Limch1 G A 5: 66,974,565 V133I probably benign Het
Mast2 C T 4: 116,307,210 A1670T probably benign Het
Mtcl1 A T 17: 66,377,947 L949Q probably benign Het
Nlrp4a T C 7: 26,459,794 V833A probably benign Het
Olfr945 A T 9: 39,257,803 Y290N probably damaging Het
Osgep C A 14: 50,917,877 A75S probably damaging Het
Pank1 C A 19: 34,878,655 R141L probably benign Het
Pcdhb20 T A 18: 37,505,254 S278T probably benign Het
Pcdhgb8 C A 18: 37,763,312 F478L probably benign Het
Peg10 C CTCT 6: 4,756,453 probably benign Het
Polr2a G A 11: 69,735,486 P1613S probably benign Het
Prom2 A C 2: 127,539,204 S251A probably benign Het
R3hdm2 A G 10: 127,484,160 H546R probably damaging Het
Reck G T 4: 43,891,011 V50L probably benign Het
Rerg T C 6: 137,056,186 T164A probably benign Het
Rho T A 6: 115,935,385 probably null Het
Ric1 A G 19: 29,597,783 T959A probably damaging Het
Slc28a3 T A 13: 58,576,795 N215I possibly damaging Het
Slc2a5 G A 4: 150,125,662 V35I probably benign Het
Srpk2 A T 5: 23,513,988 S610T probably benign Het
Tmem147 T A 7: 30,728,231 M86L probably benign Het
Trhde A G 10: 114,800,717 V195A probably benign Het
Trio T C 15: 27,773,952 S112G possibly damaging Het
U2af2 T C 7: 5,075,694 V424A probably benign Het
Vmn2r27 T C 6: 124,224,241 I252M probably benign Het
Wasf2 A G 4: 133,185,101 E88G unknown Het
Zfp37 A G 4: 62,192,003 C275R probably damaging Het
Zfp532 A T 18: 65,624,066 I357F probably damaging Het
Other mutations in Olfr358
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Olfr358 APN 2 37004930 missense probably benign 0.00
IGL01460:Olfr358 APN 2 37004636 missense probably benign 0.06
IGL02066:Olfr358 APN 2 37005309 missense probably damaging 1.00
R0081:Olfr358 UTSW 2 37005450 missense probably damaging 1.00
R0129:Olfr358 UTSW 2 37005045 nonsense probably null
R1441:Olfr358 UTSW 2 37005119 missense possibly damaging 0.82
R1543:Olfr358 UTSW 2 37005127 missense probably damaging 1.00
R1628:Olfr358 UTSW 2 37004726 missense probably damaging 1.00
R1966:Olfr358 UTSW 2 37004948 missense possibly damaging 0.49
R2338:Olfr358 UTSW 2 37005147 missense probably damaging 1.00
R4826:Olfr358 UTSW 2 37005333 missense probably damaging 0.99
R6271:Olfr358 UTSW 2 37005542 missense probably damaging 1.00
R7359:Olfr358 UTSW 2 37005437 missense probably damaging 1.00
R7487:Olfr358 UTSW 2 37004774 missense probably damaging 0.98
R7957:Olfr358 UTSW 2 37004960 missense probably benign
R8413:Olfr358 UTSW 2 37005390 missense probably damaging 1.00
R8417:Olfr358 UTSW 2 37004646 missense probably benign
R8427:Olfr358 UTSW 2 37004782 nonsense probably null
RF007:Olfr358 UTSW 2 37005174 missense probably damaging 0.99
X0028:Olfr358 UTSW 2 37005599 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTACATGCGAATCACAGAACC -3'
(R):5'- GTTGCCATCTGTGACCCTTTAAG -3'

Sequencing Primer
(F):5'- TGCGAATCACAGAACCATACAGGAG -3'
(R):5'- GATACTCTGCTATTGTCAGCCATAG -3'
Posted On2021-01-18