Incidental Mutation 'R8477:Prom2'
ID 657289
Institutional Source Beutler Lab
Gene Symbol Prom2
Ensembl Gene ENSMUSG00000027376
Gene Name prominin 2
Synonyms
MMRRC Submission 067921-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8477 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 127368873-127383337 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 127381124 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 251 (S251A)
Ref Sequence ENSEMBL: ENSMUSP00000028855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028855] [ENSMUST00000103214]
AlphaFold Q3UUY6
Predicted Effect probably benign
Transcript: ENSMUST00000028855
AA Change: S251A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000028855
Gene: ENSMUSG00000027376
AA Change: S251A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Prominin 25 808 3.6e-279 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103214
AA Change: S251A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000099503
Gene: ENSMUSG00000027376
AA Change: S251A

DomainStartEndE-ValueType
Pfam:Prominin 18 818 3e-288 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the prominin family of pentaspan membrane glycoproteins. The encoded protein localizes to basal epithelial cells and may be involved in the organization of plasma membrane microdomains. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutant mice exhibited signs of anemia, with decreased mean red blood cell count and decreased mean hemoglobin and hematocrit levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 78,924,174 (GRCm39) S94L probably benign Het
Ackr1 C T 1: 173,159,755 (GRCm39) G255R probably damaging Het
Aldh1l2 G A 10: 83,337,785 (GRCm39) T560I probably damaging Het
Arhgef25 A T 10: 127,020,266 (GRCm39) F384I probably damaging Het
Bptf T A 11: 106,943,679 (GRCm39) Q2671L probably damaging Het
Ccdc159 A G 9: 21,844,223 (GRCm39) E95G probably damaging Het
Cenpf A T 1: 189,385,385 (GRCm39) H2298Q probably benign Het
Chn2 G T 6: 54,246,467 (GRCm39) probably null Het
Csnk1g1 T C 9: 65,909,555 (GRCm39) L224P probably damaging Het
Cyp2c54 T A 19: 40,058,708 (GRCm39) K241N probably benign Het
Cyp2c55 G T 19: 38,999,485 (GRCm39) V64L probably damaging Het
Dlgap1 A C 17: 70,823,967 (GRCm39) Q317H probably damaging Het
Dnaja3 A G 16: 4,505,212 (GRCm39) D108G probably null Het
Dpagt1 G T 9: 44,243,390 (GRCm39) probably null Het
Dzip1 T C 14: 119,138,958 (GRCm39) R424G possibly damaging Het
Ero1b A G 13: 12,616,672 (GRCm39) K367R probably benign Het
Evi2 T C 11: 79,406,891 (GRCm39) Y228C probably benign Het
Exosc10 A T 4: 148,649,847 (GRCm39) I426L possibly damaging Het
Gba2 C T 4: 43,569,944 (GRCm39) R423Q probably damaging Het
Gm19965 A C 1: 116,730,854 (GRCm39) probably benign Het
Gpr165 C A X: 95,757,623 (GRCm39) D7E probably benign Het
Gvin2 T C 7: 105,548,133 (GRCm39) K1640E possibly damaging Het
Hc A T 2: 34,879,182 (GRCm39) C1557S probably damaging Het
Hfm1 C T 5: 107,029,684 (GRCm39) S799N probably benign Het
Hibadh A T 6: 52,617,185 (GRCm39) W17R probably benign Het
Hivep1 A T 13: 42,337,696 (GRCm39) T2592S probably benign Het
Ighv8-5 G A 12: 115,031,200 (GRCm39) T113I probably benign Het
Il2rb A T 15: 78,370,006 (GRCm39) V211D probably damaging Het
Itgal A G 7: 126,900,105 (GRCm39) Y121C probably damaging Het
Kirrel1 T C 3: 86,992,138 (GRCm39) T597A possibly damaging Het
Lats1 A G 10: 7,581,279 (GRCm39) E688G probably damaging Het
Lbr C T 1: 181,644,539 (GRCm39) A589T possibly damaging Het
Limch1 G A 5: 67,131,908 (GRCm39) V133I probably benign Het
Mast2 C T 4: 116,164,407 (GRCm39) A1670T probably benign Het
Mtcl1 A T 17: 66,684,942 (GRCm39) L949Q probably benign Het
Nlrp4a T C 7: 26,159,219 (GRCm39) V833A probably benign Het
Or12k5 T C 2: 36,895,060 (GRCm39) T189A probably benign Het
Or8g28 A T 9: 39,169,099 (GRCm39) Y290N probably damaging Het
Osgep C A 14: 51,155,334 (GRCm39) A75S probably damaging Het
Pank1 C A 19: 34,856,055 (GRCm39) R141L probably benign Het
Pcdhb20 T A 18: 37,638,307 (GRCm39) S278T probably benign Het
Pcdhgb8 C A 18: 37,896,365 (GRCm39) F478L probably benign Het
Peg10 C CTCT 6: 4,756,453 (GRCm39) probably benign Het
Polr2a G A 11: 69,626,312 (GRCm39) P1613S probably benign Het
Pramel55 A C 5: 95,949,567 (GRCm39) M105L probably benign Het
R3hdm2 A G 10: 127,320,029 (GRCm39) H546R probably damaging Het
Reck G T 4: 43,891,011 (GRCm39) V50L probably benign Het
Rerg T C 6: 137,033,184 (GRCm39) T164A probably benign Het
Rho T A 6: 115,912,346 (GRCm39) probably null Het
Ric1 A G 19: 29,575,183 (GRCm39) T959A probably damaging Het
Slc28a3 T A 13: 58,724,609 (GRCm39) N215I possibly damaging Het
Slc2a5 G A 4: 150,210,119 (GRCm39) V35I probably benign Het
Srpk2 A T 5: 23,718,986 (GRCm39) S610T probably benign Het
Tasor2 A G 13: 3,625,079 (GRCm39) F1624L probably benign Het
Tmem147 T A 7: 30,427,656 (GRCm39) M86L probably benign Het
Trhde A G 10: 114,636,622 (GRCm39) V195A probably benign Het
Trio T C 15: 27,774,038 (GRCm39) S112G possibly damaging Het
U2af2 T C 7: 5,078,693 (GRCm39) V424A probably benign Het
Vmn2r27 T C 6: 124,201,200 (GRCm39) I252M probably benign Het
Wasf2 A G 4: 132,912,412 (GRCm39) E88G unknown Het
Zfp37 A G 4: 62,110,240 (GRCm39) C275R probably damaging Het
Zfp532 A T 18: 65,757,137 (GRCm39) I357F probably damaging Het
Other mutations in Prom2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Prom2 APN 2 127,383,059 (GRCm39) missense probably benign 0.04
IGL01140:Prom2 APN 2 127,373,125 (GRCm39) splice site probably benign
IGL01300:Prom2 APN 2 127,377,009 (GRCm39) missense probably benign 0.44
IGL01445:Prom2 APN 2 127,381,433 (GRCm39) splice site probably benign
IGL01472:Prom2 APN 2 127,374,802 (GRCm39) missense probably benign 0.39
IGL01541:Prom2 APN 2 127,371,050 (GRCm39) critical splice donor site probably null
IGL01991:Prom2 APN 2 127,371,142 (GRCm39) missense probably damaging 1.00
IGL02421:Prom2 APN 2 127,373,802 (GRCm39) critical splice acceptor site probably null
IGL02557:Prom2 APN 2 127,371,391 (GRCm39) missense possibly damaging 0.85
IGL02724:Prom2 APN 2 127,380,577 (GRCm39) splice site probably benign
IGL02826:Prom2 APN 2 127,373,036 (GRCm39) missense probably benign 0.07
IGL02830:Prom2 APN 2 127,376,989 (GRCm39) missense possibly damaging 0.88
IGL02990:Prom2 APN 2 127,370,734 (GRCm39) missense probably benign 0.10
R0110:Prom2 UTSW 2 127,373,033 (GRCm39) missense possibly damaging 0.53
R0133:Prom2 UTSW 2 127,380,258 (GRCm39) splice site probably benign
R0165:Prom2 UTSW 2 127,381,434 (GRCm39) splice site probably benign
R0220:Prom2 UTSW 2 127,383,027 (GRCm39) missense probably benign 0.03
R0466:Prom2 UTSW 2 127,370,709 (GRCm39) missense probably damaging 0.99
R0505:Prom2 UTSW 2 127,374,787 (GRCm39) missense possibly damaging 0.82
R0605:Prom2 UTSW 2 127,381,915 (GRCm39) critical splice donor site probably null
R0633:Prom2 UTSW 2 127,381,445 (GRCm39) missense probably benign 0.19
R0947:Prom2 UTSW 2 127,380,183 (GRCm39) missense possibly damaging 0.69
R1682:Prom2 UTSW 2 127,382,082 (GRCm39) missense possibly damaging 0.90
R1806:Prom2 UTSW 2 127,374,802 (GRCm39) missense probably damaging 1.00
R1859:Prom2 UTSW 2 127,383,017 (GRCm39) missense probably damaging 0.97
R1864:Prom2 UTSW 2 127,381,707 (GRCm39) missense probably benign 0.00
R1866:Prom2 UTSW 2 127,378,514 (GRCm39) missense probably damaging 0.99
R3824:Prom2 UTSW 2 127,377,593 (GRCm39) splice site probably benign
R4472:Prom2 UTSW 2 127,382,111 (GRCm39) missense probably benign 0.06
R5078:Prom2 UTSW 2 127,373,757 (GRCm39) missense probably benign 0.00
R5889:Prom2 UTSW 2 127,371,331 (GRCm39) missense possibly damaging 0.79
R5930:Prom2 UTSW 2 127,372,053 (GRCm39) nonsense probably null
R6214:Prom2 UTSW 2 127,381,695 (GRCm39) critical splice donor site probably null
R6215:Prom2 UTSW 2 127,381,695 (GRCm39) critical splice donor site probably null
R6914:Prom2 UTSW 2 127,372,295 (GRCm39) missense possibly damaging 0.78
R7099:Prom2 UTSW 2 127,381,698 (GRCm39) missense probably benign
R7427:Prom2 UTSW 2 127,381,731 (GRCm39) missense probably damaging 0.99
R7428:Prom2 UTSW 2 127,381,731 (GRCm39) missense probably damaging 0.99
R7525:Prom2 UTSW 2 127,374,701 (GRCm39) missense probably benign
R9287:Prom2 UTSW 2 127,380,185 (GRCm39) missense probably damaging 0.98
R9337:Prom2 UTSW 2 127,371,094 (GRCm39) missense probably damaging 0.99
Z1176:Prom2 UTSW 2 127,374,695 (GRCm39) missense probably damaging 1.00
Z1177:Prom2 UTSW 2 127,381,446 (GRCm39) missense probably benign 0.19
Z1177:Prom2 UTSW 2 127,380,225 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGCCACAGTGGAAACTGC -3'
(R):5'- TTACTGCAGGATGAGGAGGC -3'

Sequencing Primer
(F):5'- AGTGGAAACTGCCTCTGGG -3'
(R):5'- CAGGATGAGGAGGCCGACC -3'
Posted On 2021-01-18