Incidental Mutation 'R8477:Gba2'
ID657291
Institutional Source Beutler Lab
Gene Symbol Gba2
Ensembl Gene ENSMUSG00000028467
Gene Nameglucosidase beta 2
Synonymsbile acid
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8477 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location43566928-43578873 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43569944 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 423 (R423Q)
Ref Sequence ENSEMBL: ENSMUSP00000030189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030189] [ENSMUST00000102944] [ENSMUST00000130443] [ENSMUST00000132631] [ENSMUST00000167751]
Predicted Effect probably damaging
Transcript: ENSMUST00000030189
AA Change: R423Q

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030189
Gene: ENSMUSG00000028467
AA Change: R423Q

DomainStartEndE-ValueType
Pfam:GBA2_N 142 446 9.4e-106 PFAM
Pfam:DUF608 512 879 1.3e-153 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102944
SMART Domains Protein: ENSMUSP00000100008
Gene: ENSMUSG00000028466

DomainStartEndE-ValueType
low complexity region 54 83 N/A INTRINSIC
low complexity region 132 147 N/A INTRINSIC
BRLZ 158 222 2.03e-15 SMART
low complexity region 240 253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130443
SMART Domains Protein: ENSMUSP00000119589
Gene: ENSMUSG00000028467

DomainStartEndE-ValueType
Pfam:GBA2_N 142 180 5.6e-13 PFAM
Pfam:GBA2_N 178 227 1.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132631
Predicted Effect probably benign
Transcript: ENSMUST00000167751
SMART Domains Protein: ENSMUSP00000129401
Gene: ENSMUSG00000028466

DomainStartEndE-ValueType
low complexity region 54 83 N/A INTRINSIC
low complexity region 156 171 N/A INTRINSIC
BRLZ 182 246 2.03e-15 SMART
low complexity region 264 277 N/A INTRINSIC
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microsomal beta-glucosidase that catalyzes the hydrolysis of bile acid 3-O-glucosides as endogenous compounds. Studies to determine subcellular localization of this protein in the liver indicated that the enzyme was mainly enriched in the microsomal fraction where it appeared to be confined to the endoplasmic reticulum. This putative transmembrane protein is thought to play a role in carbohydrate transport and metabolism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit accumulation of glucosylceramides in multiple tissues, and show impaired male fertility associated with globozoospermia, oligozoospermia, reduced sperm motility, and male germ cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 79,088,340 S94L probably benign Het
Ackr1 C T 1: 173,332,188 G255R probably damaging Het
Aldh1l2 G A 10: 83,501,921 T560I probably damaging Het
Arhgef25 A T 10: 127,184,397 F384I probably damaging Het
Bptf T A 11: 107,052,853 Q2671L probably damaging Het
Ccdc159 A G 9: 21,932,927 E95G probably damaging Het
Cenpf A T 1: 189,653,188 H2298Q probably benign Het
Chn2 G T 6: 54,269,482 probably null Het
Csnk1g1 T C 9: 66,002,273 L224P probably damaging Het
Cyp2c54 T A 19: 40,070,264 K241N probably benign Het
Cyp2c55 G T 19: 39,011,041 V64L probably damaging Het
Dlgap1 A C 17: 70,516,972 Q317H probably damaging Het
Dnaja3 A G 16: 4,687,348 D108G probably null Het
Dpagt1 G T 9: 44,332,093 probably null Het
Dzip1 T C 14: 118,901,546 R424G possibly damaging Het
E330014E10Rik A C 5: 95,801,708 M105L probably benign Het
Ero1lb A G 13: 12,601,783 K367R probably benign Het
Evi2 T C 11: 79,516,065 Y228C probably benign Het
Exosc10 A T 4: 148,565,390 I426L possibly damaging Het
Fam208b A G 13: 3,575,079 F1624L probably benign Het
Gm19965 A C 1: 116,803,124 probably benign Het
Gm4070 T C 7: 105,898,926 K1640E possibly damaging Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Hc A T 2: 34,989,170 C1557S probably damaging Het
Hfm1 C T 5: 106,881,818 S799N probably benign Het
Hibadh A T 6: 52,640,200 W17R probably benign Het
Hivep1 A T 13: 42,184,220 T2592S probably benign Het
Ighv8-5 G A 12: 115,067,580 T113I probably benign Het
Il2rb A T 15: 78,485,806 V211D probably damaging Het
Itgal A G 7: 127,300,933 Y121C probably damaging Het
Kirrel T C 3: 87,084,831 T597A possibly damaging Het
Lats1 A G 10: 7,705,515 E688G probably damaging Het
Lbr C T 1: 181,816,974 A589T possibly damaging Het
Limch1 G A 5: 66,974,565 V133I probably benign Het
Mast2 C T 4: 116,307,210 A1670T probably benign Het
Mtcl1 A T 17: 66,377,947 L949Q probably benign Het
Nlrp4a T C 7: 26,459,794 V833A probably benign Het
Olfr358 T C 2: 37,005,048 T189A probably benign Het
Olfr945 A T 9: 39,257,803 Y290N probably damaging Het
Osgep C A 14: 50,917,877 A75S probably damaging Het
Pank1 C A 19: 34,878,655 R141L probably benign Het
Pcdhb20 T A 18: 37,505,254 S278T probably benign Het
Pcdhgb8 C A 18: 37,763,312 F478L probably benign Het
Peg10 C CTCT 6: 4,756,453 probably benign Het
Polr2a G A 11: 69,735,486 P1613S probably benign Het
Prom2 A C 2: 127,539,204 S251A probably benign Het
R3hdm2 A G 10: 127,484,160 H546R probably damaging Het
Reck G T 4: 43,891,011 V50L probably benign Het
Rerg T C 6: 137,056,186 T164A probably benign Het
Rho T A 6: 115,935,385 probably null Het
Ric1 A G 19: 29,597,783 T959A probably damaging Het
Slc28a3 T A 13: 58,576,795 N215I possibly damaging Het
Slc2a5 G A 4: 150,125,662 V35I probably benign Het
Srpk2 A T 5: 23,513,988 S610T probably benign Het
Tmem147 T A 7: 30,728,231 M86L probably benign Het
Trhde A G 10: 114,800,717 V195A probably benign Het
Trio T C 15: 27,773,952 S112G possibly damaging Het
U2af2 T C 7: 5,075,694 V424A probably benign Het
Vmn2r27 T C 6: 124,224,241 I252M probably benign Het
Wasf2 A G 4: 133,185,101 E88G unknown Het
Zfp37 A G 4: 62,192,003 C275R probably damaging Het
Zfp532 A T 18: 65,624,066 I357F probably damaging Het
Other mutations in Gba2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Gba2 APN 4 43568477 missense probably damaging 1.00
IGL01577:Gba2 APN 4 43573753 nonsense probably null
IGL02066:Gba2 APN 4 43570175 missense probably benign 0.18
IGL02126:Gba2 APN 4 43567918 critical splice acceptor site probably null
IGL02243:Gba2 APN 4 43568719 missense probably benign 0.13
IGL02474:Gba2 APN 4 43568538 missense possibly damaging 0.69
IGL02567:Gba2 APN 4 43567281 missense probably benign
IGL02628:Gba2 APN 4 43568919 missense probably benign 0.01
IGL02706:Gba2 APN 4 43567257 missense probably benign 0.01
IGL02795:Gba2 APN 4 43578331 missense probably damaging 1.00
R0389:Gba2 UTSW 4 43570832 missense probably damaging 1.00
R0555:Gba2 UTSW 4 43569927 missense probably damaging 1.00
R0650:Gba2 UTSW 4 43570424 splice site probably null
R1603:Gba2 UTSW 4 43567823 missense probably damaging 1.00
R1628:Gba2 UTSW 4 43570118 missense probably benign 0.00
R1664:Gba2 UTSW 4 43578080 missense probably benign 0.01
R1686:Gba2 UTSW 4 43573869 splice site probably benign
R1730:Gba2 UTSW 4 43578242 missense probably benign 0.01
R2036:Gba2 UTSW 4 43568118 unclassified probably benign
R2061:Gba2 UTSW 4 43574029 nonsense probably null
R2259:Gba2 UTSW 4 43570107 missense probably benign
R2847:Gba2 UTSW 4 43568000 splice site probably null
R3026:Gba2 UTSW 4 43578308 missense possibly damaging 0.95
R3617:Gba2 UTSW 4 43573803 missense probably damaging 1.00
R4225:Gba2 UTSW 4 43569464 unclassified probably benign
R4346:Gba2 UTSW 4 43571337 missense probably benign 0.04
R4601:Gba2 UTSW 4 43573810 missense probably damaging 1.00
R4611:Gba2 UTSW 4 43568092 missense probably damaging 1.00
R4664:Gba2 UTSW 4 43568619 unclassified probably benign
R4784:Gba2 UTSW 4 43568315 missense probably damaging 1.00
R4785:Gba2 UTSW 4 43568315 missense probably damaging 1.00
R5079:Gba2 UTSW 4 43568640 unclassified probably benign
R5327:Gba2 UTSW 4 43574063 missense probably damaging 1.00
R5746:Gba2 UTSW 4 43568465 splice site probably null
R6052:Gba2 UTSW 4 43568330 missense probably damaging 1.00
R6485:Gba2 UTSW 4 43574118 missense probably damaging 1.00
R7073:Gba2 UTSW 4 43573753 missense probably damaging 1.00
R7112:Gba2 UTSW 4 43568453 missense probably benign 0.01
R7472:Gba2 UTSW 4 43568967 missense probably benign 0.44
R8220:Gba2 UTSW 4 43568510 missense probably damaging 1.00
R8315:Gba2 UTSW 4 43569937 frame shift probably null
R8476:Gba2 UTSW 4 43569944 missense probably damaging 0.98
R8794:Gba2 UTSW 4 43568077 missense probably damaging 0.98
RF007:Gba2 UTSW 4 43569894 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGGACACTGTGAATCCCAGC -3'
(R):5'- AAGCTGTTACCTCGAAGCCG -3'

Sequencing Primer
(F):5'- AGCCCGACAGACTGCTAG -3'
(R):5'- GGTGCTGCTTGGAGTTCTCAC -3'
Posted On2021-01-18