Incidental Mutation 'R8477:Zfp37'
ID 657293
Institutional Source Beutler Lab
Gene Symbol Zfp37
Ensembl Gene ENSMUSG00000028389
Gene Name zinc finger protein 37
Synonyms Zfp-37, Tzn
MMRRC Submission 067921-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.373) question?
Stock # R8477 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 62107774-62127634 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 62110240 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 275 (C275R)
Ref Sequence ENSEMBL: ENSMUSP00000152400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068822] [ENSMUST00000129511] [ENSMUST00000220873] [ENSMUST00000221329] [ENSMUST00000222050] [ENSMUST00000222748]
AlphaFold P17141
Predicted Effect probably damaging
Transcript: ENSMUST00000068822
AA Change: C316R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070463
Gene: ENSMUSG00000028389
AA Change: C316R

DomainStartEndE-ValueType
KRAB 13 62 5.89e-12 SMART
low complexity region 113 122 N/A INTRINSIC
ZnF_C2H2 255 277 2.75e-3 SMART
ZnF_C2H2 283 305 3.95e-4 SMART
ZnF_C2H2 311 333 2.2e-2 SMART
ZnF_C2H2 339 361 8.02e-5 SMART
ZnF_C2H2 367 389 1.13e-4 SMART
ZnF_C2H2 395 417 9.88e-5 SMART
ZnF_C2H2 423 445 2.61e-4 SMART
ZnF_C2H2 451 473 6.08e-5 SMART
ZnF_C2H2 479 501 5.99e-4 SMART
ZnF_C2H2 507 529 5.99e-4 SMART
ZnF_C2H2 535 557 1.03e-2 SMART
ZnF_C2H2 563 585 9.88e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129511
Predicted Effect probably damaging
Transcript: ENSMUST00000220873
AA Change: C275R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000221329
AA Change: C313R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000222050
AA Change: C312R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000222748
AA Change: C275R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that belongs to a large family of zinc finger proteins. A similar protein in mouse is thought to play a role in regulating the structures of the nucleolus and centromere in neurons. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 78,924,174 (GRCm39) S94L probably benign Het
Ackr1 C T 1: 173,159,755 (GRCm39) G255R probably damaging Het
Aldh1l2 G A 10: 83,337,785 (GRCm39) T560I probably damaging Het
Arhgef25 A T 10: 127,020,266 (GRCm39) F384I probably damaging Het
Bptf T A 11: 106,943,679 (GRCm39) Q2671L probably damaging Het
Ccdc159 A G 9: 21,844,223 (GRCm39) E95G probably damaging Het
Cenpf A T 1: 189,385,385 (GRCm39) H2298Q probably benign Het
Chn2 G T 6: 54,246,467 (GRCm39) probably null Het
Csnk1g1 T C 9: 65,909,555 (GRCm39) L224P probably damaging Het
Cyp2c54 T A 19: 40,058,708 (GRCm39) K241N probably benign Het
Cyp2c55 G T 19: 38,999,485 (GRCm39) V64L probably damaging Het
Dlgap1 A C 17: 70,823,967 (GRCm39) Q317H probably damaging Het
Dnaja3 A G 16: 4,505,212 (GRCm39) D108G probably null Het
Dpagt1 G T 9: 44,243,390 (GRCm39) probably null Het
Dzip1 T C 14: 119,138,958 (GRCm39) R424G possibly damaging Het
Ero1b A G 13: 12,616,672 (GRCm39) K367R probably benign Het
Evi2 T C 11: 79,406,891 (GRCm39) Y228C probably benign Het
Exosc10 A T 4: 148,649,847 (GRCm39) I426L possibly damaging Het
Gba2 C T 4: 43,569,944 (GRCm39) R423Q probably damaging Het
Gm19965 A C 1: 116,730,854 (GRCm39) probably benign Het
Gpr165 C A X: 95,757,623 (GRCm39) D7E probably benign Het
Gvin2 T C 7: 105,548,133 (GRCm39) K1640E possibly damaging Het
Hc A T 2: 34,879,182 (GRCm39) C1557S probably damaging Het
Hfm1 C T 5: 107,029,684 (GRCm39) S799N probably benign Het
Hibadh A T 6: 52,617,185 (GRCm39) W17R probably benign Het
Hivep1 A T 13: 42,337,696 (GRCm39) T2592S probably benign Het
Ighv8-5 G A 12: 115,031,200 (GRCm39) T113I probably benign Het
Il2rb A T 15: 78,370,006 (GRCm39) V211D probably damaging Het
Itgal A G 7: 126,900,105 (GRCm39) Y121C probably damaging Het
Kirrel1 T C 3: 86,992,138 (GRCm39) T597A possibly damaging Het
Lats1 A G 10: 7,581,279 (GRCm39) E688G probably damaging Het
Lbr C T 1: 181,644,539 (GRCm39) A589T possibly damaging Het
Limch1 G A 5: 67,131,908 (GRCm39) V133I probably benign Het
Mast2 C T 4: 116,164,407 (GRCm39) A1670T probably benign Het
Mtcl1 A T 17: 66,684,942 (GRCm39) L949Q probably benign Het
Nlrp4a T C 7: 26,159,219 (GRCm39) V833A probably benign Het
Or12k5 T C 2: 36,895,060 (GRCm39) T189A probably benign Het
Or8g28 A T 9: 39,169,099 (GRCm39) Y290N probably damaging Het
Osgep C A 14: 51,155,334 (GRCm39) A75S probably damaging Het
Pank1 C A 19: 34,856,055 (GRCm39) R141L probably benign Het
Pcdhb20 T A 18: 37,638,307 (GRCm39) S278T probably benign Het
Pcdhgb8 C A 18: 37,896,365 (GRCm39) F478L probably benign Het
Peg10 C CTCT 6: 4,756,453 (GRCm39) probably benign Het
Polr2a G A 11: 69,626,312 (GRCm39) P1613S probably benign Het
Pramel55 A C 5: 95,949,567 (GRCm39) M105L probably benign Het
Prom2 A C 2: 127,381,124 (GRCm39) S251A probably benign Het
R3hdm2 A G 10: 127,320,029 (GRCm39) H546R probably damaging Het
Reck G T 4: 43,891,011 (GRCm39) V50L probably benign Het
Rerg T C 6: 137,033,184 (GRCm39) T164A probably benign Het
Rho T A 6: 115,912,346 (GRCm39) probably null Het
Ric1 A G 19: 29,575,183 (GRCm39) T959A probably damaging Het
Slc28a3 T A 13: 58,724,609 (GRCm39) N215I possibly damaging Het
Slc2a5 G A 4: 150,210,119 (GRCm39) V35I probably benign Het
Srpk2 A T 5: 23,718,986 (GRCm39) S610T probably benign Het
Tasor2 A G 13: 3,625,079 (GRCm39) F1624L probably benign Het
Tmem147 T A 7: 30,427,656 (GRCm39) M86L probably benign Het
Trhde A G 10: 114,636,622 (GRCm39) V195A probably benign Het
Trio T C 15: 27,774,038 (GRCm39) S112G possibly damaging Het
U2af2 T C 7: 5,078,693 (GRCm39) V424A probably benign Het
Vmn2r27 T C 6: 124,201,200 (GRCm39) I252M probably benign Het
Wasf2 A G 4: 132,912,412 (GRCm39) E88G unknown Het
Zfp532 A T 18: 65,757,137 (GRCm39) I357F probably damaging Het
Other mutations in Zfp37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02742:Zfp37 APN 4 62,110,548 (GRCm39) missense possibly damaging 0.69
B6584:Zfp37 UTSW 4 62,109,615 (GRCm39) missense probably damaging 1.00
R0383:Zfp37 UTSW 4 62,110,122 (GRCm39) start codon destroyed probably null 0.61
R0457:Zfp37 UTSW 4 62,109,902 (GRCm39) nonsense probably null
R1258:Zfp37 UTSW 4 62,110,054 (GRCm39) missense probably damaging 1.00
R2072:Zfp37 UTSW 4 62,109,945 (GRCm39) missense probably damaging 1.00
R2073:Zfp37 UTSW 4 62,109,945 (GRCm39) missense probably damaging 1.00
R2261:Zfp37 UTSW 4 62,109,873 (GRCm39) missense probably damaging 1.00
R2262:Zfp37 UTSW 4 62,109,873 (GRCm39) missense probably damaging 1.00
R2507:Zfp37 UTSW 4 62,109,493 (GRCm39) missense probably damaging 1.00
R2897:Zfp37 UTSW 4 62,110,014 (GRCm39) missense probably damaging 1.00
R2898:Zfp37 UTSW 4 62,110,014 (GRCm39) missense probably damaging 1.00
R3826:Zfp37 UTSW 4 62,110,800 (GRCm39) missense probably benign 0.00
R3879:Zfp37 UTSW 4 62,109,572 (GRCm39) nonsense probably null
R4034:Zfp37 UTSW 4 62,109,933 (GRCm39) missense probably damaging 1.00
R4491:Zfp37 UTSW 4 62,110,365 (GRCm39) missense probably benign 0.07
R4823:Zfp37 UTSW 4 62,109,740 (GRCm39) missense probably benign 0.18
R5186:Zfp37 UTSW 4 62,109,493 (GRCm39) missense probably damaging 1.00
R5650:Zfp37 UTSW 4 62,110,002 (GRCm39) missense probably damaging 1.00
R5886:Zfp37 UTSW 4 62,109,471 (GRCm39) missense probably damaging 1.00
R5925:Zfp37 UTSW 4 62,109,450 (GRCm39) missense possibly damaging 0.47
R7050:Zfp37 UTSW 4 62,109,908 (GRCm39) missense possibly damaging 0.72
R7553:Zfp37 UTSW 4 62,110,236 (GRCm39) missense probably damaging 1.00
R7583:Zfp37 UTSW 4 62,110,253 (GRCm39) start gained probably benign
R7646:Zfp37 UTSW 4 62,109,532 (GRCm39) missense probably damaging 0.99
R8061:Zfp37 UTSW 4 62,109,665 (GRCm39) nonsense probably null
R8076:Zfp37 UTSW 4 62,109,553 (GRCm39) missense possibly damaging 0.67
R8756:Zfp37 UTSW 4 62,110,371 (GRCm39) missense possibly damaging 0.94
R9000:Zfp37 UTSW 4 62,126,651 (GRCm39) missense unknown
R9362:Zfp37 UTSW 4 62,110,299 (GRCm39) missense probably benign 0.11
R9400:Zfp37 UTSW 4 62,109,904 (GRCm39) missense probably damaging 1.00
R9745:Zfp37 UTSW 4 62,110,644 (GRCm39) missense possibly damaging 0.58
X0026:Zfp37 UTSW 4 62,123,326 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGATTTGCCACATTCCTTACATTC -3'
(R):5'- GGAAATCACACTGCCGTACTC -3'

Sequencing Primer
(F):5'- GCCACATTCCTTACATTCATACGG -3'
(R):5'- CCTTATGAATGTAACCACTGTGGG -3'
Posted On 2021-01-18