Incidental Mutation 'R8477:Wasf2'
ID 657295
Institutional Source Beutler Lab
Gene Symbol Wasf2
Ensembl Gene ENSMUSG00000028868
Gene Name WASP family, member 2
Synonyms D4Ertd13e, WAVE2
MMRRC Submission 067921-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8477 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 132857843-132927067 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 132912412 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 88 (E88G)
Ref Sequence ENSEMBL: ENSMUSP00000081263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084241] [ENSMUST00000105912] [ENSMUST00000138831]
AlphaFold Q8BH43
Predicted Effect unknown
Transcript: ENSMUST00000084241
AA Change: E88G
SMART Domains Protein: ENSMUSP00000081263
Gene: ENSMUSG00000028868
AA Change: E88G

DomainStartEndE-ValueType
PDB:4N78|D 1 219 4e-90 PDB
low complexity region 243 263 N/A INTRINSIC
low complexity region 293 403 N/A INTRINSIC
low complexity region 411 419 N/A INTRINSIC
WH2 435 452 7.02e-5 SMART
low complexity region 481 497 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000105912
AA Change: E88G
SMART Domains Protein: ENSMUSP00000101532
Gene: ENSMUSG00000028868
AA Change: E88G

DomainStartEndE-ValueType
PDB:4N78|D 1 219 4e-90 PDB
low complexity region 243 263 N/A INTRINSIC
low complexity region 293 403 N/A INTRINSIC
low complexity region 411 419 N/A INTRINSIC
WH2 435 452 7.02e-5 SMART
low complexity region 481 497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138831
SMART Domains Protein: ENSMUSP00000117314
Gene: ENSMUSG00000028868

DomainStartEndE-ValueType
PDB:3P8C|D 1 85 6e-36 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Wiskott-Aldrich syndrome protein family. The gene product is a protein that forms a multiprotein complex that links receptor kinases and actin. Binding to actin occurs through a C-terminal verprolin homology domain in all family members. The multiprotein complex serves to tranduce signals that involve changes in cell shape, motility or function. The published map location (PMID:10381382) has been changed based on recent genomic sequence comparisons, which indicate that the expressed gene is located on chromosome 1, and a pseudogene may be located on chromosome X. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutants show impaired embryonic development and do not survive to term. In addition to reduced embryo size, observed defects include hemorrhaging, abnormal somite development, perturbed angiogenesis, and shrunken cerebral ventricles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 78,924,174 (GRCm39) S94L probably benign Het
Ackr1 C T 1: 173,159,755 (GRCm39) G255R probably damaging Het
Aldh1l2 G A 10: 83,337,785 (GRCm39) T560I probably damaging Het
Arhgef25 A T 10: 127,020,266 (GRCm39) F384I probably damaging Het
Bptf T A 11: 106,943,679 (GRCm39) Q2671L probably damaging Het
Ccdc159 A G 9: 21,844,223 (GRCm39) E95G probably damaging Het
Cenpf A T 1: 189,385,385 (GRCm39) H2298Q probably benign Het
Chn2 G T 6: 54,246,467 (GRCm39) probably null Het
Csnk1g1 T C 9: 65,909,555 (GRCm39) L224P probably damaging Het
Cyp2c54 T A 19: 40,058,708 (GRCm39) K241N probably benign Het
Cyp2c55 G T 19: 38,999,485 (GRCm39) V64L probably damaging Het
Dlgap1 A C 17: 70,823,967 (GRCm39) Q317H probably damaging Het
Dnaja3 A G 16: 4,505,212 (GRCm39) D108G probably null Het
Dpagt1 G T 9: 44,243,390 (GRCm39) probably null Het
Dzip1 T C 14: 119,138,958 (GRCm39) R424G possibly damaging Het
Ero1b A G 13: 12,616,672 (GRCm39) K367R probably benign Het
Evi2 T C 11: 79,406,891 (GRCm39) Y228C probably benign Het
Exosc10 A T 4: 148,649,847 (GRCm39) I426L possibly damaging Het
Gba2 C T 4: 43,569,944 (GRCm39) R423Q probably damaging Het
Gm19965 A C 1: 116,730,854 (GRCm39) probably benign Het
Gpr165 C A X: 95,757,623 (GRCm39) D7E probably benign Het
Gvin2 T C 7: 105,548,133 (GRCm39) K1640E possibly damaging Het
Hc A T 2: 34,879,182 (GRCm39) C1557S probably damaging Het
Hfm1 C T 5: 107,029,684 (GRCm39) S799N probably benign Het
Hibadh A T 6: 52,617,185 (GRCm39) W17R probably benign Het
Hivep1 A T 13: 42,337,696 (GRCm39) T2592S probably benign Het
Ighv8-5 G A 12: 115,031,200 (GRCm39) T113I probably benign Het
Il2rb A T 15: 78,370,006 (GRCm39) V211D probably damaging Het
Itgal A G 7: 126,900,105 (GRCm39) Y121C probably damaging Het
Kirrel1 T C 3: 86,992,138 (GRCm39) T597A possibly damaging Het
Lats1 A G 10: 7,581,279 (GRCm39) E688G probably damaging Het
Lbr C T 1: 181,644,539 (GRCm39) A589T possibly damaging Het
Limch1 G A 5: 67,131,908 (GRCm39) V133I probably benign Het
Mast2 C T 4: 116,164,407 (GRCm39) A1670T probably benign Het
Mtcl1 A T 17: 66,684,942 (GRCm39) L949Q probably benign Het
Nlrp4a T C 7: 26,159,219 (GRCm39) V833A probably benign Het
Or12k5 T C 2: 36,895,060 (GRCm39) T189A probably benign Het
Or8g28 A T 9: 39,169,099 (GRCm39) Y290N probably damaging Het
Osgep C A 14: 51,155,334 (GRCm39) A75S probably damaging Het
Pank1 C A 19: 34,856,055 (GRCm39) R141L probably benign Het
Pcdhb20 T A 18: 37,638,307 (GRCm39) S278T probably benign Het
Pcdhgb8 C A 18: 37,896,365 (GRCm39) F478L probably benign Het
Peg10 C CTCT 6: 4,756,453 (GRCm39) probably benign Het
Polr2a G A 11: 69,626,312 (GRCm39) P1613S probably benign Het
Pramel55 A C 5: 95,949,567 (GRCm39) M105L probably benign Het
Prom2 A C 2: 127,381,124 (GRCm39) S251A probably benign Het
R3hdm2 A G 10: 127,320,029 (GRCm39) H546R probably damaging Het
Reck G T 4: 43,891,011 (GRCm39) V50L probably benign Het
Rerg T C 6: 137,033,184 (GRCm39) T164A probably benign Het
Rho T A 6: 115,912,346 (GRCm39) probably null Het
Ric1 A G 19: 29,575,183 (GRCm39) T959A probably damaging Het
Slc28a3 T A 13: 58,724,609 (GRCm39) N215I possibly damaging Het
Slc2a5 G A 4: 150,210,119 (GRCm39) V35I probably benign Het
Srpk2 A T 5: 23,718,986 (GRCm39) S610T probably benign Het
Tasor2 A G 13: 3,625,079 (GRCm39) F1624L probably benign Het
Tmem147 T A 7: 30,427,656 (GRCm39) M86L probably benign Het
Trhde A G 10: 114,636,622 (GRCm39) V195A probably benign Het
Trio T C 15: 27,774,038 (GRCm39) S112G possibly damaging Het
U2af2 T C 7: 5,078,693 (GRCm39) V424A probably benign Het
Vmn2r27 T C 6: 124,201,200 (GRCm39) I252M probably benign Het
Zfp37 A G 4: 62,110,240 (GRCm39) C275R probably damaging Het
Zfp532 A T 18: 65,757,137 (GRCm39) I357F probably damaging Het
Other mutations in Wasf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01784:Wasf2 APN 4 132,919,439 (GRCm39) missense unknown
IGL02028:Wasf2 APN 4 132,923,112 (GRCm39) missense probably damaging 1.00
IGL03196:Wasf2 APN 4 132,921,732 (GRCm39) missense unknown
IGL03225:Wasf2 APN 4 132,903,857 (GRCm39) missense probably benign
Syndrome UTSW 4 132,922,220 (GRCm39) critical splice donor site probably null
R1551:Wasf2 UTSW 4 132,917,483 (GRCm39) missense unknown
R1646:Wasf2 UTSW 4 132,903,902 (GRCm39) missense probably benign 0.25
R4776:Wasf2 UTSW 4 132,912,315 (GRCm39) missense probably benign
R4929:Wasf2 UTSW 4 132,923,170 (GRCm39) missense unknown
R5042:Wasf2 UTSW 4 132,903,875 (GRCm39) missense probably benign 0.37
R6803:Wasf2 UTSW 4 132,922,220 (GRCm39) critical splice donor site probably null
R6889:Wasf2 UTSW 4 132,922,041 (GRCm39) missense unknown
R7208:Wasf2 UTSW 4 132,923,045 (GRCm39) missense probably damaging 1.00
R7421:Wasf2 UTSW 4 132,912,412 (GRCm39) missense unknown
R8707:Wasf2 UTSW 4 132,917,540 (GRCm39) missense unknown
R9566:Wasf2 UTSW 4 132,921,766 (GRCm39) missense unknown
R9650:Wasf2 UTSW 4 132,917,457 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TGCACTAGTGACTTGCTCTG -3'
(R):5'- ATCTTGCAGGCCTCTCCATG -3'

Sequencing Primer
(F):5'- GCACTAGTGACTTGCTCTGTTTGC -3'
(R):5'- CCTCTCCATGGGTGAAATGAGTC -3'
Posted On 2021-01-18