Incidental Mutation 'R8477:U2af2'
ID 657306
Institutional Source Beutler Lab
Gene Symbol U2af2
Ensembl Gene ENSMUSG00000030435
Gene Name U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 2
Synonyms
MMRRC Submission 067921-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.966) question?
Stock # R8477 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 5065142-5082937 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 5078693 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 424 (V424A)
Ref Sequence ENSEMBL: ENSMUSP00000147013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005041] [ENSMUST00000045277] [ENSMUST00000098845] [ENSMUST00000146317] [ENSMUST00000153169] [ENSMUST00000165399] [ENSMUST00000209099]
AlphaFold P26369
Predicted Effect probably benign
Transcript: ENSMUST00000005041
AA Change: V420A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000005041
Gene: ENSMUSG00000030435
AA Change: V420A

DomainStartEndE-ValueType
low complexity region 23 62 N/A INTRINSIC
PDB:1JMT|B 85 112 9e-13 PDB
RRM 150 227 1.26e-11 SMART
low complexity region 242 257 N/A INTRINSIC
RRM 260 333 8.64e-19 SMART
RRM 377 462 3.04e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000045277
SMART Domains Protein: ENSMUSP00000043340
Gene: ENSMUSG00000035203

DomainStartEndE-ValueType
ENTH 18 144 5.84e-65 SMART
low complexity region 157 174 N/A INTRINSIC
UIM 183 202 2.94e-1 SMART
UIM 208 227 4.15e-1 SMART
UIM 233 252 5.48e-1 SMART
low complexity region 279 293 N/A INTRINSIC
low complexity region 294 316 N/A INTRINSIC
low complexity region 332 350 N/A INTRINSIC
low complexity region 363 379 N/A INTRINSIC
low complexity region 454 466 N/A INTRINSIC
low complexity region 536 545 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098845
SMART Domains Protein: ENSMUSP00000096445
Gene: ENSMUSG00000035203

DomainStartEndE-ValueType
ENTH 18 144 5.84e-65 SMART
low complexity region 157 174 N/A INTRINSIC
UIM 183 202 2.94e-1 SMART
UIM 208 227 4.15e-1 SMART
UIM 233 252 5.48e-1 SMART
low complexity region 279 293 N/A INTRINSIC
low complexity region 294 316 N/A INTRINSIC
low complexity region 332 350 N/A INTRINSIC
low complexity region 363 379 N/A INTRINSIC
low complexity region 454 466 N/A INTRINSIC
low complexity region 536 545 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146317
SMART Domains Protein: ENSMUSP00000116571
Gene: ENSMUSG00000035203

DomainStartEndE-ValueType
Pfam:ENTH 17 90 7.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153169
SMART Domains Protein: ENSMUSP00000122594
Gene: ENSMUSG00000035203

DomainStartEndE-ValueType
Pfam:ENTH 17 54 3.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165399
AA Change: V256A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131458
Gene: ENSMUSG00000030435
AA Change: V256A

DomainStartEndE-ValueType
RRM 8 63 3.31e0 SMART
low complexity region 78 93 N/A INTRINSIC
RRM 96 169 8.64e-19 SMART
RRM 209 294 3.04e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209099
AA Change: V424A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000207498
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] U2 auxiliary factor (U2AF), comprised of a large and a small subunit, is a non-snRNP protein required for the binding of U2 snRNP to the pre-mRNA branch site. This gene encodes the U2AF large subunit which contains a sequence-specific RNA-binding region with 3 RNA recognition motifs and an Arg/Ser-rich domain necessary for splicing. The large subunit binds to the polypyrimidine tract of introns early during spliceosome assembly. Multiple transcript variants have been detected for this gene, but the full-length natures of only two have been determined to date. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 78,924,174 (GRCm39) S94L probably benign Het
Ackr1 C T 1: 173,159,755 (GRCm39) G255R probably damaging Het
Aldh1l2 G A 10: 83,337,785 (GRCm39) T560I probably damaging Het
Arhgef25 A T 10: 127,020,266 (GRCm39) F384I probably damaging Het
Bptf T A 11: 106,943,679 (GRCm39) Q2671L probably damaging Het
Ccdc159 A G 9: 21,844,223 (GRCm39) E95G probably damaging Het
Cenpf A T 1: 189,385,385 (GRCm39) H2298Q probably benign Het
Chn2 G T 6: 54,246,467 (GRCm39) probably null Het
Csnk1g1 T C 9: 65,909,555 (GRCm39) L224P probably damaging Het
Cyp2c54 T A 19: 40,058,708 (GRCm39) K241N probably benign Het
Cyp2c55 G T 19: 38,999,485 (GRCm39) V64L probably damaging Het
Dlgap1 A C 17: 70,823,967 (GRCm39) Q317H probably damaging Het
Dnaja3 A G 16: 4,505,212 (GRCm39) D108G probably null Het
Dpagt1 G T 9: 44,243,390 (GRCm39) probably null Het
Dzip1 T C 14: 119,138,958 (GRCm39) R424G possibly damaging Het
Ero1b A G 13: 12,616,672 (GRCm39) K367R probably benign Het
Evi2 T C 11: 79,406,891 (GRCm39) Y228C probably benign Het
Exosc10 A T 4: 148,649,847 (GRCm39) I426L possibly damaging Het
Gba2 C T 4: 43,569,944 (GRCm39) R423Q probably damaging Het
Gm19965 A C 1: 116,730,854 (GRCm39) probably benign Het
Gpr165 C A X: 95,757,623 (GRCm39) D7E probably benign Het
Gvin2 T C 7: 105,548,133 (GRCm39) K1640E possibly damaging Het
Hc A T 2: 34,879,182 (GRCm39) C1557S probably damaging Het
Hfm1 C T 5: 107,029,684 (GRCm39) S799N probably benign Het
Hibadh A T 6: 52,617,185 (GRCm39) W17R probably benign Het
Hivep1 A T 13: 42,337,696 (GRCm39) T2592S probably benign Het
Ighv8-5 G A 12: 115,031,200 (GRCm39) T113I probably benign Het
Il2rb A T 15: 78,370,006 (GRCm39) V211D probably damaging Het
Itgal A G 7: 126,900,105 (GRCm39) Y121C probably damaging Het
Kirrel1 T C 3: 86,992,138 (GRCm39) T597A possibly damaging Het
Lats1 A G 10: 7,581,279 (GRCm39) E688G probably damaging Het
Lbr C T 1: 181,644,539 (GRCm39) A589T possibly damaging Het
Limch1 G A 5: 67,131,908 (GRCm39) V133I probably benign Het
Mast2 C T 4: 116,164,407 (GRCm39) A1670T probably benign Het
Mtcl1 A T 17: 66,684,942 (GRCm39) L949Q probably benign Het
Nlrp4a T C 7: 26,159,219 (GRCm39) V833A probably benign Het
Or12k5 T C 2: 36,895,060 (GRCm39) T189A probably benign Het
Or8g28 A T 9: 39,169,099 (GRCm39) Y290N probably damaging Het
Osgep C A 14: 51,155,334 (GRCm39) A75S probably damaging Het
Pank1 C A 19: 34,856,055 (GRCm39) R141L probably benign Het
Pcdhb20 T A 18: 37,638,307 (GRCm39) S278T probably benign Het
Pcdhgb8 C A 18: 37,896,365 (GRCm39) F478L probably benign Het
Peg10 C CTCT 6: 4,756,453 (GRCm39) probably benign Het
Polr2a G A 11: 69,626,312 (GRCm39) P1613S probably benign Het
Pramel55 A C 5: 95,949,567 (GRCm39) M105L probably benign Het
Prom2 A C 2: 127,381,124 (GRCm39) S251A probably benign Het
R3hdm2 A G 10: 127,320,029 (GRCm39) H546R probably damaging Het
Reck G T 4: 43,891,011 (GRCm39) V50L probably benign Het
Rerg T C 6: 137,033,184 (GRCm39) T164A probably benign Het
Rho T A 6: 115,912,346 (GRCm39) probably null Het
Ric1 A G 19: 29,575,183 (GRCm39) T959A probably damaging Het
Slc28a3 T A 13: 58,724,609 (GRCm39) N215I possibly damaging Het
Slc2a5 G A 4: 150,210,119 (GRCm39) V35I probably benign Het
Srpk2 A T 5: 23,718,986 (GRCm39) S610T probably benign Het
Tasor2 A G 13: 3,625,079 (GRCm39) F1624L probably benign Het
Tmem147 T A 7: 30,427,656 (GRCm39) M86L probably benign Het
Trhde A G 10: 114,636,622 (GRCm39) V195A probably benign Het
Trio T C 15: 27,774,038 (GRCm39) S112G possibly damaging Het
Vmn2r27 T C 6: 124,201,200 (GRCm39) I252M probably benign Het
Wasf2 A G 4: 132,912,412 (GRCm39) E88G unknown Het
Zfp37 A G 4: 62,110,240 (GRCm39) C275R probably damaging Het
Zfp532 A T 18: 65,757,137 (GRCm39) I357F probably damaging Het
Other mutations in U2af2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03368:U2af2 APN 7 5,070,263 (GRCm39) splice site probably benign
IGL02980:U2af2 UTSW 7 5,071,042 (GRCm39) missense probably benign 0.37
R0919:U2af2 UTSW 7 5,072,433 (GRCm39) splice site probably benign
R1768:U2af2 UTSW 7 5,070,544 (GRCm39) missense probably benign 0.00
R2228:U2af2 UTSW 7 5,078,672 (GRCm39) missense probably damaging 1.00
R2697:U2af2 UTSW 7 5,070,545 (GRCm39) missense probably benign 0.00
R3974:U2af2 UTSW 7 5,072,438 (GRCm39) splice site probably null
R5777:U2af2 UTSW 7 5,069,450 (GRCm39) missense probably benign 0.37
R5916:U2af2 UTSW 7 5,082,179 (GRCm39) critical splice acceptor site probably null
R6290:U2af2 UTSW 7 5,078,683 (GRCm39) missense probably benign
R6860:U2af2 UTSW 7 5,082,273 (GRCm39) missense possibly damaging 0.77
R7827:U2af2 UTSW 7 5,077,661 (GRCm39) critical splice donor site probably null
R8300:U2af2 UTSW 7 5,070,414 (GRCm39) intron probably benign
R8727:U2af2 UTSW 7 5,070,432 (GRCm39) intron probably benign
R8857:U2af2 UTSW 7 5,065,290 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAGATCTGTTCTCCCTGACC -3'
(R):5'- GAAATCAATTTCTCCACTATAGGCC -3'

Sequencing Primer
(F):5'- GACACCTGTGACCCTTCAAGTG -3'
(R):5'- ATTTCTCCACTATAGGCCCCAAG -3'
Posted On 2021-01-18