Incidental Mutation 'R8477:Itgal'
ID 657310
Institutional Source Beutler Lab
Gene Symbol Itgal
Ensembl Gene ENSMUSG00000030830
Gene Name integrin alpha L
Synonyms Ly-21, Ly-15, Cd11a, LFA-1
MMRRC Submission 067921-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.143) question?
Stock # R8477 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 126895432-126934310 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 126900105 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 121 (Y121C)
Ref Sequence ENSEMBL: ENSMUSP00000131847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106306] [ENSMUST00000117762] [ENSMUST00000120857] [ENSMUST00000170971]
AlphaFold P24063
Predicted Effect probably damaging
Transcript: ENSMUST00000106306
AA Change: Y121C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101913
Gene: ENSMUSG00000030830
AA Change: Y121C

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1043 1059 N/A INTRINSIC
transmembrane domain 1087 1109 N/A INTRINSIC
Pfam:Integrin_alpha 1110 1124 5.8e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117762
AA Change: Y121C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113946
Gene: ENSMUSG00000030830
AA Change: Y121C

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1042 1058 N/A INTRINSIC
transmembrane domain 1086 1108 N/A INTRINSIC
Pfam:Integrin_alpha 1109 1123 5.8e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120857
AA Change: Y121C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113396
Gene: ENSMUSG00000030830
AA Change: Y121C

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1042 1058 N/A INTRINSIC
transmembrane domain 1086 1108 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170971
AA Change: Y121C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131847
Gene: ENSMUSG00000030830
AA Change: Y121C

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1042 1058 N/A INTRINSIC
transmembrane domain 1086 1108 N/A INTRINSIC
Pfam:Integrin_alpha 1109 1123 1.2e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ITGAL encodes the integrin alpha L chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form the integrin lymphocyte function-associated antigen-1 (LFA-1), which is expressed on all leukocytes. LFA-1 plays a central role in leukocyte intercellular adhesion through interactions with its ligands, ICAMs 1-3 (intercellular adhesion molecules 1 through 3), and also functions in lymphocyte costimulatory signaling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mutations of this gene lead to increased leukocyte cell number, alter T cell activation, leukocyte migration and adhesion, spleen and lymph node morphology, and may affect humoral immune responses, metastatic potential, and susceptibility to endotoxin shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 78,924,174 (GRCm39) S94L probably benign Het
Ackr1 C T 1: 173,159,755 (GRCm39) G255R probably damaging Het
Aldh1l2 G A 10: 83,337,785 (GRCm39) T560I probably damaging Het
Arhgef25 A T 10: 127,020,266 (GRCm39) F384I probably damaging Het
Bptf T A 11: 106,943,679 (GRCm39) Q2671L probably damaging Het
Ccdc159 A G 9: 21,844,223 (GRCm39) E95G probably damaging Het
Cenpf A T 1: 189,385,385 (GRCm39) H2298Q probably benign Het
Chn2 G T 6: 54,246,467 (GRCm39) probably null Het
Csnk1g1 T C 9: 65,909,555 (GRCm39) L224P probably damaging Het
Cyp2c54 T A 19: 40,058,708 (GRCm39) K241N probably benign Het
Cyp2c55 G T 19: 38,999,485 (GRCm39) V64L probably damaging Het
Dlgap1 A C 17: 70,823,967 (GRCm39) Q317H probably damaging Het
Dnaja3 A G 16: 4,505,212 (GRCm39) D108G probably null Het
Dpagt1 G T 9: 44,243,390 (GRCm39) probably null Het
Dzip1 T C 14: 119,138,958 (GRCm39) R424G possibly damaging Het
Ero1b A G 13: 12,616,672 (GRCm39) K367R probably benign Het
Evi2 T C 11: 79,406,891 (GRCm39) Y228C probably benign Het
Exosc10 A T 4: 148,649,847 (GRCm39) I426L possibly damaging Het
Gba2 C T 4: 43,569,944 (GRCm39) R423Q probably damaging Het
Gm19965 A C 1: 116,730,854 (GRCm39) probably benign Het
Gpr165 C A X: 95,757,623 (GRCm39) D7E probably benign Het
Gvin2 T C 7: 105,548,133 (GRCm39) K1640E possibly damaging Het
Hc A T 2: 34,879,182 (GRCm39) C1557S probably damaging Het
Hfm1 C T 5: 107,029,684 (GRCm39) S799N probably benign Het
Hibadh A T 6: 52,617,185 (GRCm39) W17R probably benign Het
Hivep1 A T 13: 42,337,696 (GRCm39) T2592S probably benign Het
Ighv8-5 G A 12: 115,031,200 (GRCm39) T113I probably benign Het
Il2rb A T 15: 78,370,006 (GRCm39) V211D probably damaging Het
Kirrel1 T C 3: 86,992,138 (GRCm39) T597A possibly damaging Het
Lats1 A G 10: 7,581,279 (GRCm39) E688G probably damaging Het
Lbr C T 1: 181,644,539 (GRCm39) A589T possibly damaging Het
Limch1 G A 5: 67,131,908 (GRCm39) V133I probably benign Het
Mast2 C T 4: 116,164,407 (GRCm39) A1670T probably benign Het
Mtcl1 A T 17: 66,684,942 (GRCm39) L949Q probably benign Het
Nlrp4a T C 7: 26,159,219 (GRCm39) V833A probably benign Het
Or12k5 T C 2: 36,895,060 (GRCm39) T189A probably benign Het
Or8g28 A T 9: 39,169,099 (GRCm39) Y290N probably damaging Het
Osgep C A 14: 51,155,334 (GRCm39) A75S probably damaging Het
Pank1 C A 19: 34,856,055 (GRCm39) R141L probably benign Het
Pcdhb20 T A 18: 37,638,307 (GRCm39) S278T probably benign Het
Pcdhgb8 C A 18: 37,896,365 (GRCm39) F478L probably benign Het
Peg10 C CTCT 6: 4,756,453 (GRCm39) probably benign Het
Polr2a G A 11: 69,626,312 (GRCm39) P1613S probably benign Het
Pramel55 A C 5: 95,949,567 (GRCm39) M105L probably benign Het
Prom2 A C 2: 127,381,124 (GRCm39) S251A probably benign Het
R3hdm2 A G 10: 127,320,029 (GRCm39) H546R probably damaging Het
Reck G T 4: 43,891,011 (GRCm39) V50L probably benign Het
Rerg T C 6: 137,033,184 (GRCm39) T164A probably benign Het
Rho T A 6: 115,912,346 (GRCm39) probably null Het
Ric1 A G 19: 29,575,183 (GRCm39) T959A probably damaging Het
Slc28a3 T A 13: 58,724,609 (GRCm39) N215I possibly damaging Het
Slc2a5 G A 4: 150,210,119 (GRCm39) V35I probably benign Het
Srpk2 A T 5: 23,718,986 (GRCm39) S610T probably benign Het
Tasor2 A G 13: 3,625,079 (GRCm39) F1624L probably benign Het
Tmem147 T A 7: 30,427,656 (GRCm39) M86L probably benign Het
Trhde A G 10: 114,636,622 (GRCm39) V195A probably benign Het
Trio T C 15: 27,774,038 (GRCm39) S112G possibly damaging Het
U2af2 T C 7: 5,078,693 (GRCm39) V424A probably benign Het
Vmn2r27 T C 6: 124,201,200 (GRCm39) I252M probably benign Het
Wasf2 A G 4: 132,912,412 (GRCm39) E88G unknown Het
Zfp37 A G 4: 62,110,240 (GRCm39) C275R probably damaging Het
Zfp532 A T 18: 65,757,137 (GRCm39) I357F probably damaging Het
Other mutations in Itgal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Itgal APN 7 126,901,183 (GRCm39) missense probably damaging 0.99
IGL01300:Itgal APN 7 126,913,290 (GRCm39) missense probably damaging 1.00
IGL01345:Itgal APN 7 126,900,128 (GRCm39) missense possibly damaging 0.56
IGL01826:Itgal APN 7 126,901,318 (GRCm39) missense probably benign 0.16
IGL02202:Itgal APN 7 126,929,351 (GRCm39) nonsense probably null
IGL02212:Itgal APN 7 126,900,152 (GRCm39) missense probably benign 0.00
IGL02513:Itgal APN 7 126,927,844 (GRCm39) missense possibly damaging 0.78
IGL02608:Itgal APN 7 126,909,416 (GRCm39) missense probably damaging 1.00
IGL02946:Itgal APN 7 126,913,540 (GRCm39) missense probably damaging 0.99
sunglow UTSW 7 126,927,919 (GRCm39) missense probably null 0.89
R0069:Itgal UTSW 7 126,909,503 (GRCm39) missense probably benign 0.44
R0069:Itgal UTSW 7 126,909,503 (GRCm39) missense probably benign 0.44
R0107:Itgal UTSW 7 126,927,731 (GRCm39) splice site probably benign
R0331:Itgal UTSW 7 126,905,853 (GRCm39) splice site probably null
R0350:Itgal UTSW 7 126,921,253 (GRCm39) missense probably damaging 1.00
R0380:Itgal UTSW 7 126,909,923 (GRCm39) nonsense probably null
R0537:Itgal UTSW 7 126,910,445 (GRCm39) missense possibly damaging 0.61
R0546:Itgal UTSW 7 126,909,486 (GRCm39) missense probably benign 0.00
R0594:Itgal UTSW 7 126,913,232 (GRCm39) missense probably damaging 1.00
R1167:Itgal UTSW 7 126,900,111 (GRCm39) missense probably damaging 1.00
R1377:Itgal UTSW 7 126,921,089 (GRCm39) missense probably damaging 1.00
R1575:Itgal UTSW 7 126,900,060 (GRCm39) critical splice acceptor site probably null
R1690:Itgal UTSW 7 126,901,289 (GRCm39) missense possibly damaging 0.56
R1693:Itgal UTSW 7 126,904,453 (GRCm39) missense probably damaging 1.00
R1702:Itgal UTSW 7 126,904,197 (GRCm39) missense probably benign 0.00
R1720:Itgal UTSW 7 126,906,099 (GRCm39) missense probably benign 0.00
R1774:Itgal UTSW 7 126,908,794 (GRCm39) critical splice donor site probably null
R1824:Itgal UTSW 7 126,913,232 (GRCm39) missense probably damaging 1.00
R1878:Itgal UTSW 7 126,909,843 (GRCm39) missense probably benign 0.44
R1951:Itgal UTSW 7 126,929,317 (GRCm39) missense probably damaging 1.00
R2265:Itgal UTSW 7 126,905,873 (GRCm39) missense possibly damaging 0.63
R2267:Itgal UTSW 7 126,905,873 (GRCm39) missense possibly damaging 0.63
R2269:Itgal UTSW 7 126,905,873 (GRCm39) missense possibly damaging 0.63
R2276:Itgal UTSW 7 126,927,919 (GRCm39) missense probably null 0.89
R2570:Itgal UTSW 7 126,913,268 (GRCm39) missense probably damaging 1.00
R3925:Itgal UTSW 7 126,923,709 (GRCm39) splice site probably benign
R4225:Itgal UTSW 7 126,904,484 (GRCm39) missense probably damaging 1.00
R4377:Itgal UTSW 7 126,927,453 (GRCm39) missense probably benign 0.00
R4466:Itgal UTSW 7 126,927,684 (GRCm39) missense possibly damaging 0.93
R4579:Itgal UTSW 7 126,904,466 (GRCm39) missense possibly damaging 0.83
R4656:Itgal UTSW 7 126,921,725 (GRCm39) missense probably damaging 1.00
R4771:Itgal UTSW 7 126,927,405 (GRCm39) missense probably damaging 1.00
R5012:Itgal UTSW 7 126,898,802 (GRCm39) critical splice donor site probably null
R5328:Itgal UTSW 7 126,910,847 (GRCm39) critical splice donor site probably null
R5365:Itgal UTSW 7 126,904,522 (GRCm39) missense probably damaging 0.98
R5579:Itgal UTSW 7 126,906,101 (GRCm39) missense probably benign 0.10
R5849:Itgal UTSW 7 126,916,492 (GRCm39) missense probably benign 0.27
R5955:Itgal UTSW 7 126,904,161 (GRCm39) missense possibly damaging 0.82
R6254:Itgal UTSW 7 126,924,375 (GRCm39) missense probably damaging 1.00
R6269:Itgal UTSW 7 126,929,389 (GRCm39) missense probably null 1.00
R6520:Itgal UTSW 7 126,929,503 (GRCm39) missense probably benign 0.01
R6541:Itgal UTSW 7 126,910,734 (GRCm39) missense probably damaging 0.99
R7049:Itgal UTSW 7 126,895,573 (GRCm39) unclassified probably benign
R7168:Itgal UTSW 7 126,929,385 (GRCm39) missense probably benign
R7419:Itgal UTSW 7 126,906,047 (GRCm39) missense probably benign 0.01
R7424:Itgal UTSW 7 126,916,537 (GRCm39) missense probably benign 0.00
R7454:Itgal UTSW 7 126,926,936 (GRCm39) missense probably benign 0.00
R7567:Itgal UTSW 7 126,898,960 (GRCm39) missense probably benign 0.00
R7696:Itgal UTSW 7 126,929,356 (GRCm39) missense probably damaging 1.00
R7977:Itgal UTSW 7 126,927,470 (GRCm39) missense possibly damaging 0.88
R7987:Itgal UTSW 7 126,927,470 (GRCm39) missense possibly damaging 0.88
R8118:Itgal UTSW 7 126,910,417 (GRCm39) missense probably benign 0.08
R8297:Itgal UTSW 7 126,929,638 (GRCm39) missense unknown
R8418:Itgal UTSW 7 126,929,454 (GRCm39) missense probably benign 0.02
R8507:Itgal UTSW 7 126,928,607 (GRCm39) missense probably benign 0.26
R8789:Itgal UTSW 7 126,904,421 (GRCm39) missense probably benign 0.05
R8838:Itgal UTSW 7 126,910,433 (GRCm39) missense probably damaging 1.00
R8881:Itgal UTSW 7 126,929,541 (GRCm39) missense probably benign 0.11
R8923:Itgal UTSW 7 126,895,533 (GRCm39) unclassified probably benign
R9070:Itgal UTSW 7 126,927,873 (GRCm39) missense probably null 0.98
R9104:Itgal UTSW 7 126,910,794 (GRCm39) missense probably damaging 1.00
R9173:Itgal UTSW 7 126,896,789 (GRCm39) critical splice acceptor site probably null
R9179:Itgal UTSW 7 126,905,883 (GRCm39) missense probably benign 0.33
R9407:Itgal UTSW 7 126,921,796 (GRCm39) critical splice donor site probably null
R9545:Itgal UTSW 7 126,929,422 (GRCm39) missense probably damaging 1.00
R9681:Itgal UTSW 7 126,929,422 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATTGTTATAGAACGCTGGCTG -3'
(R):5'- CAGAGGTGACATGCAAACCG -3'

Sequencing Primer
(F):5'- ATAGAACGCTGGCTGCCTTAG -3'
(R):5'- CCGGTCTGACTGATAAAAGCTTAGC -3'
Posted On 2021-01-18