Mutagenetix > Incidental Mutations

Incidental Mutation 'R8477:Lats1'

657315

Institutional Source

Beutler Lab

Gene Symbol

Lats1

Ensembl Gene

ENSMUSG00000040021

Gene Name

large tumor suppressor

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.792) question?

Stock #

R8477 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

7681214-7716460 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 7705515 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 688 (E688G)

Ref Sequence

ENSEMBL: ENSMUSP00000151533 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]

AlphaFold

Q8BYR2

Predicted Effect

probably damaging
Transcript: ENSMUST00000040043
AA Change: E688G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: E688G

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000165952
AA Change: E688G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: E688G

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000217931
AA Change: E688G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.7486

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	G	A	10: 79,088,340	S94L	probably benign	Het
Ackr1	C	T	1: 173,332,188	G255R	probably damaging	Het
Aldh1l2	G	A	10: 83,501,921	T560I	probably damaging	Het
Arhgef25	A	T	10: 127,184,397	F384I	probably damaging	Het
Bptf	T	A	11: 107,052,853	Q2671L	probably damaging	Het
Ccdc159	A	G	9: 21,932,927	E95G	probably damaging	Het
Cenpf	A	T	1: 189,653,188	H2298Q	probably benign	Het
Chn2	G	T	6: 54,269,482		probably null	Het
Csnk1g1	T	C	9: 66,002,273	L224P	probably damaging	Het
Cyp2c54	T	A	19: 40,070,264	K241N	probably benign	Het
Cyp2c55	G	T	19: 39,011,041	V64L	probably damaging	Het
Dlgap1	A	C	17: 70,516,972	Q317H	probably damaging	Het
Dnaja3	A	G	16: 4,687,348	D108G	probably null	Het
Dpagt1	G	T	9: 44,332,093		probably null	Het
Dzip1	T	C	14: 118,901,546	R424G	possibly damaging	Het
E330014E10Rik	A	C	5: 95,801,708	M105L	probably benign	Het
Ero1lb	A	G	13: 12,601,783	K367R	probably benign	Het
Evi2	T	C	11: 79,516,065	Y228C	probably benign	Het
Exosc10	A	T	4: 148,565,390	I426L	possibly damaging	Het
Fam208b	A	G	13: 3,575,079	F1624L	probably benign	Het
Gba2	C	T	4: 43,569,944	R423Q	probably damaging	Het
Gm19965	A	C	1: 116,803,124		probably benign	Het
Gm4070	T	C	7: 105,898,926	K1640E	possibly damaging	Het
Gpr165	C	A	X: 96,714,017	D7E	probably benign	Het
Hc	A	T	2: 34,989,170	C1557S	probably damaging	Het
Hfm1	C	T	5: 106,881,818	S799N	probably benign	Het
Hibadh	A	T	6: 52,640,200	W17R	probably benign	Het
Hivep1	A	T	13: 42,184,220	T2592S	probably benign	Het
Ighv8-5	G	A	12: 115,067,580	T113I	probably benign	Het
Il2rb	A	T	15: 78,485,806	V211D	probably damaging	Het
Itgal	A	G	7: 127,300,933	Y121C	probably damaging	Het
Kirrel	T	C	3: 87,084,831	T597A	possibly damaging	Het
Lbr	C	T	1: 181,816,974	A589T	possibly damaging	Het
Limch1	G	A	5: 66,974,565	V133I	probably benign	Het
Mast2	C	T	4: 116,307,210	A1670T	probably benign	Het
Mtcl1	A	T	17: 66,377,947	L949Q	probably benign	Het
Nlrp4a	T	C	7: 26,459,794	V833A	probably benign	Het
Olfr358	T	C	2: 37,005,048	T189A	probably benign	Het
Olfr945	A	T	9: 39,257,803	Y290N	probably damaging	Het
Osgep	C	A	14: 50,917,877	A75S	probably damaging	Het
Pank1	C	A	19: 34,878,655	R141L	probably benign	Het
Pcdhb20	T	A	18: 37,505,254	S278T	probably benign	Het
Pcdhgb8	C	A	18: 37,763,312	F478L	probably benign	Het
Peg10	C	CTCT	6: 4,756,453		probably benign	Het
Polr2a	G	A	11: 69,735,486	P1613S	probably benign	Het
Prom2	A	C	2: 127,539,204	S251A	probably benign	Het
R3hdm2	A	G	10: 127,484,160	H546R	probably damaging	Het
Reck	G	T	4: 43,891,011	V50L	probably benign	Het
Rerg	T	C	6: 137,056,186	T164A	probably benign	Het
Rho	T	A	6: 115,935,385		probably null	Het
Ric1	A	G	19: 29,597,783	T959A	probably damaging	Het
Slc28a3	T	A	13: 58,576,795	N215I	possibly damaging	Het
Slc2a5	G	A	4: 150,125,662	V35I	probably benign	Het
Srpk2	A	T	5: 23,513,988	S610T	probably benign	Het
Tmem147	T	A	7: 30,728,231	M86L	probably benign	Het
Trhde	A	G	10: 114,800,717	V195A	probably benign	Het
Trio	T	C	15: 27,773,952	S112G	possibly damaging	Het
U2af2	T	C	7: 5,075,694	V424A	probably benign	Het
Vmn2r27	T	C	6: 124,224,241	I252M	probably benign	Het
Wasf2	A	G	4: 133,185,101	E88G	unknown	Het
Zfp37	A	G	4: 62,192,003	C275R	probably damaging	Het
Zfp532	A	T	18: 65,624,066	I357F	probably damaging	Het

Other mutations in Lats1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Lats1	APN	10	7691566	missense	probably damaging	0.99
IGL00595:Lats1	APN	10	7702305	missense	probably benign	0.00
IGL00932:Lats1	APN	10	7712742	missense	possibly damaging	0.69
IGL01019:Lats1	APN	10	7705671	missense	probably damaging	1.00
IGL01380:Lats1	APN	10	7691780	missense	possibly damaging	0.69
IGL01965:Lats1	APN	10	7701706	missense	probably benign	0.10
IGL02027:Lats1	APN	10	7712948	missense	probably benign
IGL02611:Lats1	APN	10	7705787	missense	possibly damaging	0.91
IGL02997:Lats1	APN	10	7702254	missense	possibly damaging	0.53
IGL03107:Lats1	APN	10	7712746	missense	probably benign	0.15
I1329:Lats1	UTSW	10	7712802	missense	probably benign	0.10
PIT4378001:Lats1	UTSW	10	7705605	missense	probably damaging	1.00
R0153:Lats1	UTSW	10	7691575	missense	probably damaging	1.00
R0568:Lats1	UTSW	10	7712528	missense	possibly damaging	0.69
R0581:Lats1	UTSW	10	7702941	missense	possibly damaging	0.67
R0604:Lats1	UTSW	10	7712661	missense	probably damaging	0.96
R1681:Lats1	UTSW	10	7705914	missense	probably damaging	0.99
R1694:Lats1	UTSW	10	7701945	missense	probably benign	0.07
R1840:Lats1	UTSW	10	7710939	nonsense	probably null
R1914:Lats1	UTSW	10	7710457	splice site	probably benign
R2137:Lats1	UTSW	10	7701847	missense	possibly damaging	0.71
R2317:Lats1	UTSW	10	7691776	nonsense	probably null
R3863:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R3864:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R4597:Lats1	UTSW	10	7691746	missense	probably benign	0.00
R4657:Lats1	UTSW	10	7705684	missense	possibly damaging	0.82
R4658:Lats1	UTSW	10	7702729	missense	probably benign
R4663:Lats1	UTSW	10	7712583	missense	probably damaging	1.00
R4870:Lats1	UTSW	10	7705785	missense	probably damaging	1.00
R5101:Lats1	UTSW	10	7712584	nonsense	probably null
R5134:Lats1	UTSW	10	7691811	missense	probably benign	0.34
R5150:Lats1	UTSW	10	7712651	missense	probably benign
R5546:Lats1	UTSW	10	7705754	missense	probably damaging	0.99
R5820:Lats1	UTSW	10	7705908	missense	probably damaging	1.00
R6006:Lats1	UTSW	10	7705595	missense	probably damaging	1.00
R6301:Lats1	UTSW	10	7703107	missense	probably benign	0.01
R6544:Lats1	UTSW	10	7701670	missense	possibly damaging	0.94
R6647:Lats1	UTSW	10	7697507	missense	possibly damaging	0.81
R6874:Lats1	UTSW	10	7710851	missense	probably damaging	1.00
R7328:Lats1	UTSW	10	7705547	missense	possibly damaging	0.62
R7390:Lats1	UTSW	10	7702095	nonsense	probably null
R7438:Lats1	UTSW	10	7712942	nonsense	probably null
R7457:Lats1	UTSW	10	7710891	missense	probably damaging	1.00
R7524:Lats1	UTSW	10	7701978	missense	possibly damaging	0.89
R7593:Lats1	UTSW	10	7701712	missense	probably damaging	1.00
R7736:Lats1	UTSW	10	7702364	missense	probably damaging	1.00
R7884:Lats1	UTSW	10	7697526	nonsense	probably null
R8166:Lats1	UTSW	10	7702116	missense	probably benign
R8248:Lats1	UTSW	10	7705903	missense	probably damaging	1.00
R8458:Lats1	UTSW	10	7710924	nonsense	probably null
R8547:Lats1	UTSW	10	7712849	missense	probably damaging	1.00
R9163:Lats1	UTSW	10	7702288	missense	probably benign
R9441:Lats1	UTSW	10	7702917	missense	probably damaging	0.96
RF021:Lats1	UTSW	10	7710608	missense	probably damaging	1.00
X0026:Lats1	UTSW	10	7710623	missense	probably damaging	1.00
X0053:Lats1	UTSW	10	7691609	missense	probably benign	0.00
Z1176:Lats1	UTSW	10	7705809	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCACACGTACTCACTTTGTG -3'
(R):5'- ACCTGATTTCGGAGCAGAACG -3'

Sequencing Primer
(F):5'- GCACACGTACTCACTTTGTGTAGTG -3'
(R):5'- TCGGAGCAGAACGTCTTTC -3'

Posted On

2021-01-18