Incidental Mutation 'R8477:Trhde'
ID 657318
Institutional Source Beutler Lab
Gene Symbol Trhde
Ensembl Gene ENSMUSG00000050663
Gene Name TRH-degrading enzyme
Synonyms 9330155P21Rik
MMRRC Submission 067921-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R8477 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 114234725-114638207 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 114636622 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 195 (V195A)
Ref Sequence ENSEMBL: ENSMUSP00000057449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061632]
AlphaFold Q8K093
Predicted Effect probably benign
Transcript: ENSMUST00000061632
AA Change: V195A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000057449
Gene: ENSMUSG00000050663
AA Change: V195A

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
Pfam:Peptidase_M1 141 531 2.6e-141 PFAM
Pfam:ERAP1_C 679 1004 5.7e-65 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase M1 family. The encoded protein is an extracellular peptidase that specifically cleaves and inactivates the neuropeptide thyrotropin-releasing hormone.[provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 78,924,174 (GRCm39) S94L probably benign Het
Ackr1 C T 1: 173,159,755 (GRCm39) G255R probably damaging Het
Aldh1l2 G A 10: 83,337,785 (GRCm39) T560I probably damaging Het
Arhgef25 A T 10: 127,020,266 (GRCm39) F384I probably damaging Het
Bptf T A 11: 106,943,679 (GRCm39) Q2671L probably damaging Het
Ccdc159 A G 9: 21,844,223 (GRCm39) E95G probably damaging Het
Cenpf A T 1: 189,385,385 (GRCm39) H2298Q probably benign Het
Chn2 G T 6: 54,246,467 (GRCm39) probably null Het
Csnk1g1 T C 9: 65,909,555 (GRCm39) L224P probably damaging Het
Cyp2c54 T A 19: 40,058,708 (GRCm39) K241N probably benign Het
Cyp2c55 G T 19: 38,999,485 (GRCm39) V64L probably damaging Het
Dlgap1 A C 17: 70,823,967 (GRCm39) Q317H probably damaging Het
Dnaja3 A G 16: 4,505,212 (GRCm39) D108G probably null Het
Dpagt1 G T 9: 44,243,390 (GRCm39) probably null Het
Dzip1 T C 14: 119,138,958 (GRCm39) R424G possibly damaging Het
Ero1b A G 13: 12,616,672 (GRCm39) K367R probably benign Het
Evi2 T C 11: 79,406,891 (GRCm39) Y228C probably benign Het
Exosc10 A T 4: 148,649,847 (GRCm39) I426L possibly damaging Het
Gba2 C T 4: 43,569,944 (GRCm39) R423Q probably damaging Het
Gm19965 A C 1: 116,730,854 (GRCm39) probably benign Het
Gpr165 C A X: 95,757,623 (GRCm39) D7E probably benign Het
Gvin2 T C 7: 105,548,133 (GRCm39) K1640E possibly damaging Het
Hc A T 2: 34,879,182 (GRCm39) C1557S probably damaging Het
Hfm1 C T 5: 107,029,684 (GRCm39) S799N probably benign Het
Hibadh A T 6: 52,617,185 (GRCm39) W17R probably benign Het
Hivep1 A T 13: 42,337,696 (GRCm39) T2592S probably benign Het
Ighv8-5 G A 12: 115,031,200 (GRCm39) T113I probably benign Het
Il2rb A T 15: 78,370,006 (GRCm39) V211D probably damaging Het
Itgal A G 7: 126,900,105 (GRCm39) Y121C probably damaging Het
Kirrel1 T C 3: 86,992,138 (GRCm39) T597A possibly damaging Het
Lats1 A G 10: 7,581,279 (GRCm39) E688G probably damaging Het
Lbr C T 1: 181,644,539 (GRCm39) A589T possibly damaging Het
Limch1 G A 5: 67,131,908 (GRCm39) V133I probably benign Het
Mast2 C T 4: 116,164,407 (GRCm39) A1670T probably benign Het
Mtcl1 A T 17: 66,684,942 (GRCm39) L949Q probably benign Het
Nlrp4a T C 7: 26,159,219 (GRCm39) V833A probably benign Het
Or12k5 T C 2: 36,895,060 (GRCm39) T189A probably benign Het
Or8g28 A T 9: 39,169,099 (GRCm39) Y290N probably damaging Het
Osgep C A 14: 51,155,334 (GRCm39) A75S probably damaging Het
Pank1 C A 19: 34,856,055 (GRCm39) R141L probably benign Het
Pcdhb20 T A 18: 37,638,307 (GRCm39) S278T probably benign Het
Pcdhgb8 C A 18: 37,896,365 (GRCm39) F478L probably benign Het
Peg10 C CTCT 6: 4,756,453 (GRCm39) probably benign Het
Polr2a G A 11: 69,626,312 (GRCm39) P1613S probably benign Het
Pramel55 A C 5: 95,949,567 (GRCm39) M105L probably benign Het
Prom2 A C 2: 127,381,124 (GRCm39) S251A probably benign Het
R3hdm2 A G 10: 127,320,029 (GRCm39) H546R probably damaging Het
Reck G T 4: 43,891,011 (GRCm39) V50L probably benign Het
Rerg T C 6: 137,033,184 (GRCm39) T164A probably benign Het
Rho T A 6: 115,912,346 (GRCm39) probably null Het
Ric1 A G 19: 29,575,183 (GRCm39) T959A probably damaging Het
Slc28a3 T A 13: 58,724,609 (GRCm39) N215I possibly damaging Het
Slc2a5 G A 4: 150,210,119 (GRCm39) V35I probably benign Het
Srpk2 A T 5: 23,718,986 (GRCm39) S610T probably benign Het
Tasor2 A G 13: 3,625,079 (GRCm39) F1624L probably benign Het
Tmem147 T A 7: 30,427,656 (GRCm39) M86L probably benign Het
Trio T C 15: 27,774,038 (GRCm39) S112G possibly damaging Het
U2af2 T C 7: 5,078,693 (GRCm39) V424A probably benign Het
Vmn2r27 T C 6: 124,201,200 (GRCm39) I252M probably benign Het
Wasf2 A G 4: 132,912,412 (GRCm39) E88G unknown Het
Zfp37 A G 4: 62,110,240 (GRCm39) C275R probably damaging Het
Zfp532 A T 18: 65,757,137 (GRCm39) I357F probably damaging Het
Other mutations in Trhde
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Trhde APN 10 114,322,652 (GRCm39) missense possibly damaging 0.77
IGL00516:Trhde APN 10 114,282,104 (GRCm39) missense probably benign 0.01
IGL01371:Trhde APN 10 114,424,405 (GRCm39) missense possibly damaging 0.57
IGL01488:Trhde APN 10 114,282,063 (GRCm39) missense possibly damaging 0.58
IGL01602:Trhde APN 10 114,623,848 (GRCm39) missense probably benign
IGL01605:Trhde APN 10 114,623,848 (GRCm39) missense probably benign
IGL02150:Trhde APN 10 114,428,013 (GRCm39) missense probably damaging 1.00
IGL02165:Trhde APN 10 114,428,066 (GRCm39) missense probably damaging 1.00
IGL02340:Trhde APN 10 114,428,118 (GRCm39) splice site probably benign
IGL02412:Trhde APN 10 114,322,830 (GRCm39) missense probably damaging 1.00
IGL02421:Trhde APN 10 114,248,366 (GRCm39) missense probably damaging 1.00
IGL02496:Trhde APN 10 114,636,466 (GRCm39) nonsense probably null
IGL02952:Trhde APN 10 114,636,478 (GRCm39) missense probably damaging 0.99
IGL03197:Trhde APN 10 114,249,213 (GRCm39) missense probably benign 0.00
Cata UTSW 10 114,427,971 (GRCm39) missense probably damaging 1.00
l3-37 UTSW 10 114,636,986 (GRCm39) missense probably benign
Pelte UTSW 10 114,322,609 (GRCm39) critical splice donor site probably null
G1Funyon:Trhde UTSW 10 114,322,911 (GRCm39) missense probably benign 0.03
R0360:Trhde UTSW 10 114,338,887 (GRCm39) splice site probably benign
R0364:Trhde UTSW 10 114,338,887 (GRCm39) splice site probably benign
R0457:Trhde UTSW 10 114,284,167 (GRCm39) missense probably benign 0.37
R0589:Trhde UTSW 10 114,284,229 (GRCm39) missense probably benign 0.01
R1132:Trhde UTSW 10 114,248,383 (GRCm39) missense possibly damaging 0.86
R1288:Trhde UTSW 10 114,637,195 (GRCm39) missense probably benign 0.37
R1569:Trhde UTSW 10 114,282,093 (GRCm39) missense possibly damaging 0.78
R1776:Trhde UTSW 10 114,636,508 (GRCm39) missense probably benign 0.06
R1781:Trhde UTSW 10 114,424,405 (GRCm39) missense possibly damaging 0.57
R1927:Trhde UTSW 10 114,636,754 (GRCm39) missense probably damaging 1.00
R1976:Trhde UTSW 10 114,424,336 (GRCm39) missense possibly damaging 0.57
R2011:Trhde UTSW 10 114,334,698 (GRCm39) missense probably benign 0.02
R2332:Trhde UTSW 10 114,428,070 (GRCm39) missense probably damaging 1.00
R2356:Trhde UTSW 10 114,237,421 (GRCm39) missense probably damaging 1.00
R3107:Trhde UTSW 10 114,427,971 (GRCm39) missense probably damaging 1.00
R3108:Trhde UTSW 10 114,427,971 (GRCm39) missense probably damaging 1.00
R3907:Trhde UTSW 10 114,636,601 (GRCm39) missense possibly damaging 0.72
R4067:Trhde UTSW 10 114,280,585 (GRCm39) nonsense probably null
R4214:Trhde UTSW 10 114,623,975 (GRCm39) missense possibly damaging 0.51
R4428:Trhde UTSW 10 114,339,028 (GRCm39) missense probably damaging 1.00
R4429:Trhde UTSW 10 114,339,028 (GRCm39) missense probably damaging 1.00
R4430:Trhde UTSW 10 114,339,028 (GRCm39) missense probably damaging 1.00
R5244:Trhde UTSW 10 114,636,986 (GRCm39) missense probably benign
R5456:Trhde UTSW 10 114,322,665 (GRCm39) missense possibly damaging 0.58
R5540:Trhde UTSW 10 114,636,497 (GRCm39) missense probably benign 0.45
R5699:Trhde UTSW 10 114,424,407 (GRCm39) missense probably benign 0.00
R5967:Trhde UTSW 10 114,403,039 (GRCm39) missense probably damaging 1.00
R6326:Trhde UTSW 10 114,403,129 (GRCm39) missense probably damaging 1.00
R6467:Trhde UTSW 10 114,340,103 (GRCm39) missense probably damaging 1.00
R7028:Trhde UTSW 10 114,354,082 (GRCm39) missense probably damaging 1.00
R7264:Trhde UTSW 10 114,636,776 (GRCm39) missense possibly damaging 0.93
R7266:Trhde UTSW 10 114,636,776 (GRCm39) missense possibly damaging 0.93
R7310:Trhde UTSW 10 114,636,478 (GRCm39) missense probably damaging 0.99
R7460:Trhde UTSW 10 114,249,168 (GRCm39) missense probably damaging 1.00
R7732:Trhde UTSW 10 114,623,969 (GRCm39) missense probably benign
R7842:Trhde UTSW 10 114,532,003 (GRCm39) missense possibly damaging 0.86
R8178:Trhde UTSW 10 114,244,598 (GRCm39) missense possibly damaging 0.93
R8209:Trhde UTSW 10 114,403,133 (GRCm39) missense probably damaging 1.00
R8226:Trhde UTSW 10 114,403,133 (GRCm39) missense probably damaging 1.00
R8232:Trhde UTSW 10 114,636,442 (GRCm39) missense possibly damaging 0.90
R8301:Trhde UTSW 10 114,322,911 (GRCm39) missense probably benign 0.03
R8312:Trhde UTSW 10 114,249,192 (GRCm39) missense probably damaging 1.00
R8335:Trhde UTSW 10 114,322,609 (GRCm39) critical splice donor site probably null
R8853:Trhde UTSW 10 114,636,830 (GRCm39) missense probably benign
R8953:Trhde UTSW 10 114,338,966 (GRCm39) missense probably damaging 0.98
R9375:Trhde UTSW 10 114,244,598 (GRCm39) missense probably damaging 0.99
R9477:Trhde UTSW 10 114,338,980 (GRCm39) missense probably benign 0.03
R9486:Trhde UTSW 10 114,532,014 (GRCm39) missense possibly damaging 0.89
R9502:Trhde UTSW 10 114,636,697 (GRCm39) missense probably damaging 1.00
Z1177:Trhde UTSW 10 114,284,294 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATTAGAAGCCAACTGGGTCC -3'
(R):5'- AGCAGCTTTCCAGGTTCTG -3'

Sequencing Primer
(F):5'- TGGATCACGTAGGAGCTGC -3'
(R):5'- GGAATCCTCTCAGCGTGAG -3'
Posted On 2021-01-18