Incidental Mutation 'R8477:Arhgef25'
ID 657319
Institutional Source Beutler Lab
Gene Symbol Arhgef25
Ensembl Gene ENSMUSG00000019467
Gene Name Rho guanine nucleotide exchange factor 25
Synonyms GEFT, D10Ertd610e, 2410008H17Rik
MMRRC Submission 067921-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.203) question?
Stock # R8477 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 127018394-127025952 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 127020266 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 384 (F384I)
Ref Sequence ENSEMBL: ENSMUSP00000152503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019611] [ENSMUST00000095270] [ENSMUST00000167353] [ENSMUST00000218587] [ENSMUST00000218654] [ENSMUST00000219245] [ENSMUST00000222006] [ENSMUST00000222911]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000019611
AA Change: F384I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000019611
Gene: ENSMUSG00000019467
AA Change: F384I

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 81 103 N/A INTRINSIC
low complexity region 146 171 N/A INTRINSIC
RhoGEF 203 374 2.45e-49 SMART
PH 394 507 6.67e-1 SMART
low complexity region 561 569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095270
SMART Domains Protein: ENSMUSP00000092904
Gene: ENSMUSG00000040441

DomainStartEndE-ValueType
low complexity region 51 78 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
Pfam:Sulfate_transp 105 497 5.5e-103 PFAM
low complexity region 512 522 N/A INTRINSIC
Pfam:STAS 549 664 3.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167353
AA Change: F375I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126339
Gene: ENSMUSG00000019467
AA Change: F375I

DomainStartEndE-ValueType
low complexity region 72 94 N/A INTRINSIC
low complexity region 137 162 N/A INTRINSIC
RhoGEF 194 365 2.45e-49 SMART
PH 385 498 6.67e-1 SMART
low complexity region 552 560 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218587
Predicted Effect probably damaging
Transcript: ENSMUST00000218654
AA Change: F345I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000218864
Predicted Effect probably benign
Transcript: ENSMUST00000219245
Predicted Effect probably damaging
Transcript: ENSMUST00000222006
AA Change: F384I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000222911
Meta Mutation Damage Score 0.4317 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases alternate between an inactive GDP-bound state and an active GTP-bound state, and GEFs facilitate GDP/GTP exchange. This gene encodes a guanine nucleotide exchange factor (GEF) which interacts with Rho GTPases involved in contraction of vascular smooth muscles, regulation of responses to angiotensin II and lens cell differentiation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a conditional allele activated in the second heart field exhibit normal cardiac development and prenatal survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 78,924,174 (GRCm39) S94L probably benign Het
Ackr1 C T 1: 173,159,755 (GRCm39) G255R probably damaging Het
Aldh1l2 G A 10: 83,337,785 (GRCm39) T560I probably damaging Het
Bptf T A 11: 106,943,679 (GRCm39) Q2671L probably damaging Het
Ccdc159 A G 9: 21,844,223 (GRCm39) E95G probably damaging Het
Cenpf A T 1: 189,385,385 (GRCm39) H2298Q probably benign Het
Chn2 G T 6: 54,246,467 (GRCm39) probably null Het
Csnk1g1 T C 9: 65,909,555 (GRCm39) L224P probably damaging Het
Cyp2c54 T A 19: 40,058,708 (GRCm39) K241N probably benign Het
Cyp2c55 G T 19: 38,999,485 (GRCm39) V64L probably damaging Het
Dlgap1 A C 17: 70,823,967 (GRCm39) Q317H probably damaging Het
Dnaja3 A G 16: 4,505,212 (GRCm39) D108G probably null Het
Dpagt1 G T 9: 44,243,390 (GRCm39) probably null Het
Dzip1 T C 14: 119,138,958 (GRCm39) R424G possibly damaging Het
Ero1b A G 13: 12,616,672 (GRCm39) K367R probably benign Het
Evi2 T C 11: 79,406,891 (GRCm39) Y228C probably benign Het
Exosc10 A T 4: 148,649,847 (GRCm39) I426L possibly damaging Het
Gba2 C T 4: 43,569,944 (GRCm39) R423Q probably damaging Het
Gm19965 A C 1: 116,730,854 (GRCm39) probably benign Het
Gpr165 C A X: 95,757,623 (GRCm39) D7E probably benign Het
Gvin2 T C 7: 105,548,133 (GRCm39) K1640E possibly damaging Het
Hc A T 2: 34,879,182 (GRCm39) C1557S probably damaging Het
Hfm1 C T 5: 107,029,684 (GRCm39) S799N probably benign Het
Hibadh A T 6: 52,617,185 (GRCm39) W17R probably benign Het
Hivep1 A T 13: 42,337,696 (GRCm39) T2592S probably benign Het
Ighv8-5 G A 12: 115,031,200 (GRCm39) T113I probably benign Het
Il2rb A T 15: 78,370,006 (GRCm39) V211D probably damaging Het
Itgal A G 7: 126,900,105 (GRCm39) Y121C probably damaging Het
Kirrel1 T C 3: 86,992,138 (GRCm39) T597A possibly damaging Het
Lats1 A G 10: 7,581,279 (GRCm39) E688G probably damaging Het
Lbr C T 1: 181,644,539 (GRCm39) A589T possibly damaging Het
Limch1 G A 5: 67,131,908 (GRCm39) V133I probably benign Het
Mast2 C T 4: 116,164,407 (GRCm39) A1670T probably benign Het
Mtcl1 A T 17: 66,684,942 (GRCm39) L949Q probably benign Het
Nlrp4a T C 7: 26,159,219 (GRCm39) V833A probably benign Het
Or12k5 T C 2: 36,895,060 (GRCm39) T189A probably benign Het
Or8g28 A T 9: 39,169,099 (GRCm39) Y290N probably damaging Het
Osgep C A 14: 51,155,334 (GRCm39) A75S probably damaging Het
Pank1 C A 19: 34,856,055 (GRCm39) R141L probably benign Het
Pcdhb20 T A 18: 37,638,307 (GRCm39) S278T probably benign Het
Pcdhgb8 C A 18: 37,896,365 (GRCm39) F478L probably benign Het
Peg10 C CTCT 6: 4,756,453 (GRCm39) probably benign Het
Polr2a G A 11: 69,626,312 (GRCm39) P1613S probably benign Het
Pramel55 A C 5: 95,949,567 (GRCm39) M105L probably benign Het
Prom2 A C 2: 127,381,124 (GRCm39) S251A probably benign Het
R3hdm2 A G 10: 127,320,029 (GRCm39) H546R probably damaging Het
Reck G T 4: 43,891,011 (GRCm39) V50L probably benign Het
Rerg T C 6: 137,033,184 (GRCm39) T164A probably benign Het
Rho T A 6: 115,912,346 (GRCm39) probably null Het
Ric1 A G 19: 29,575,183 (GRCm39) T959A probably damaging Het
Slc28a3 T A 13: 58,724,609 (GRCm39) N215I possibly damaging Het
Slc2a5 G A 4: 150,210,119 (GRCm39) V35I probably benign Het
Srpk2 A T 5: 23,718,986 (GRCm39) S610T probably benign Het
Tasor2 A G 13: 3,625,079 (GRCm39) F1624L probably benign Het
Tmem147 T A 7: 30,427,656 (GRCm39) M86L probably benign Het
Trhde A G 10: 114,636,622 (GRCm39) V195A probably benign Het
Trio T C 15: 27,774,038 (GRCm39) S112G possibly damaging Het
U2af2 T C 7: 5,078,693 (GRCm39) V424A probably benign Het
Vmn2r27 T C 6: 124,201,200 (GRCm39) I252M probably benign Het
Wasf2 A G 4: 132,912,412 (GRCm39) E88G unknown Het
Zfp37 A G 4: 62,110,240 (GRCm39) C275R probably damaging Het
Zfp532 A T 18: 65,757,137 (GRCm39) I357F probably damaging Het
Other mutations in Arhgef25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Arhgef25 APN 10 127,020,039 (GRCm39) missense probably damaging 1.00
IGL02499:Arhgef25 APN 10 127,021,460 (GRCm39) missense probably damaging 1.00
IGL03276:Arhgef25 APN 10 127,021,794 (GRCm39) missense possibly damaging 0.78
R0021:Arhgef25 UTSW 10 127,025,423 (GRCm39) missense probably benign 0.00
R0038:Arhgef25 UTSW 10 127,022,734 (GRCm39) splice site probably benign
R0038:Arhgef25 UTSW 10 127,022,734 (GRCm39) splice site probably benign
R0106:Arhgef25 UTSW 10 127,019,879 (GRCm39) critical splice donor site probably null
R0242:Arhgef25 UTSW 10 127,019,933 (GRCm39) missense probably damaging 1.00
R0242:Arhgef25 UTSW 10 127,019,933 (GRCm39) missense probably damaging 1.00
R0358:Arhgef25 UTSW 10 127,020,322 (GRCm39) missense probably damaging 1.00
R0505:Arhgef25 UTSW 10 127,019,566 (GRCm39) missense probably null 0.03
R0676:Arhgef25 UTSW 10 127,019,879 (GRCm39) critical splice donor site probably null
R1185:Arhgef25 UTSW 10 127,019,650 (GRCm39) missense possibly damaging 0.85
R1185:Arhgef25 UTSW 10 127,019,650 (GRCm39) missense possibly damaging 0.85
R1185:Arhgef25 UTSW 10 127,019,650 (GRCm39) missense possibly damaging 0.85
R1600:Arhgef25 UTSW 10 127,021,158 (GRCm39) missense probably damaging 0.99
R1846:Arhgef25 UTSW 10 127,021,733 (GRCm39) missense probably damaging 1.00
R2055:Arhgef25 UTSW 10 127,021,004 (GRCm39) missense probably damaging 1.00
R2254:Arhgef25 UTSW 10 127,025,390 (GRCm39) missense probably benign 0.01
R2496:Arhgef25 UTSW 10 127,023,063 (GRCm39) missense probably benign 0.08
R3836:Arhgef25 UTSW 10 127,025,605 (GRCm39) missense probably benign
R3837:Arhgef25 UTSW 10 127,025,605 (GRCm39) missense probably benign
R3838:Arhgef25 UTSW 10 127,025,605 (GRCm39) missense probably benign
R3839:Arhgef25 UTSW 10 127,025,605 (GRCm39) missense probably benign
R3950:Arhgef25 UTSW 10 127,021,013 (GRCm39) missense probably damaging 1.00
R3980:Arhgef25 UTSW 10 127,023,089 (GRCm39) missense probably damaging 1.00
R4883:Arhgef25 UTSW 10 127,018,802 (GRCm39) missense probably benign 0.43
R4964:Arhgef25 UTSW 10 127,021,472 (GRCm39) missense probably damaging 1.00
R5192:Arhgef25 UTSW 10 127,020,978 (GRCm39) missense probably damaging 1.00
R5196:Arhgef25 UTSW 10 127,020,978 (GRCm39) missense probably damaging 1.00
R5420:Arhgef25 UTSW 10 127,023,143 (GRCm39) missense probably benign 0.37
R6301:Arhgef25 UTSW 10 127,021,751 (GRCm39) missense possibly damaging 0.88
R6764:Arhgef25 UTSW 10 127,019,970 (GRCm39) missense probably damaging 1.00
R7096:Arhgef25 UTSW 10 127,019,897 (GRCm39) missense probably damaging 1.00
R7289:Arhgef25 UTSW 10 127,019,641 (GRCm39) missense possibly damaging 0.92
R7482:Arhgef25 UTSW 10 127,021,540 (GRCm39) missense probably damaging 1.00
R8170:Arhgef25 UTSW 10 127,023,048 (GRCm39) missense probably damaging 1.00
R8364:Arhgef25 UTSW 10 127,025,632 (GRCm39) missense unknown
R8987:Arhgef25 UTSW 10 127,018,735 (GRCm39) missense probably damaging 1.00
R9014:Arhgef25 UTSW 10 127,019,607 (GRCm39) missense probably damaging 1.00
R9036:Arhgef25 UTSW 10 127,019,089 (GRCm39) missense probably benign
R9654:Arhgef25 UTSW 10 127,021,955 (GRCm39) missense probably damaging 1.00
X0018:Arhgef25 UTSW 10 127,019,568 (GRCm39) missense probably damaging 1.00
X0024:Arhgef25 UTSW 10 127,019,126 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAGTTTTCCCTGGAACCG -3'
(R):5'- TACCACAGTCTCAGGGTGGTTC -3'

Sequencing Primer
(F):5'- CGAAGGACATGGCCTCTGAG -3'
(R):5'- TCTGCTTTCAGGGAGAGGCC -3'
Posted On 2021-01-18