Incidental Mutation 'R8477:R3hdm2'
ID 657320
Institutional Source Beutler Lab
Gene Symbol R3hdm2
Ensembl Gene ENSMUSG00000025404
Gene Name R3H domain containing 2
Synonyms 1300003K24Rik
MMRRC Submission 067921-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.548) question?
Stock # R8477 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 127216201-127335253 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 127320029 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 546 (H546R)
Ref Sequence ENSEMBL: ENSMUSP00000100886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064793] [ENSMUST00000077046] [ENSMUST00000105249] [ENSMUST00000105250] [ENSMUST00000105251] [ENSMUST00000164161] [ENSMUST00000164831] [ENSMUST00000166820] [ENSMUST00000168079] [ENSMUST00000169888] [ENSMUST00000170336]
AlphaFold Q80TM6
Predicted Effect possibly damaging
Transcript: ENSMUST00000064793
AA Change: H519R

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000069724
Gene: ENSMUSG00000025404
AA Change: H519R

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
low complexity region 306 318 N/A INTRINSIC
low complexity region 398 429 N/A INTRINSIC
low complexity region 442 457 N/A INTRINSIC
low complexity region 699 730 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000077046
AA Change: H564R

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076303
Gene: ENSMUSG00000025404
AA Change: H564R

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 7.4e-14 PFAM
low complexity region 338 350 N/A INTRINSIC
low complexity region 430 461 N/A INTRINSIC
low complexity region 474 499 N/A INTRINSIC
low complexity region 744 775 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105249
AA Change: H512R

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000100884
Gene: ENSMUSG00000025404
AA Change: H512R

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.4e-12 PFAM
low complexity region 320 332 N/A INTRINSIC
low complexity region 412 443 N/A INTRINSIC
low complexity region 692 723 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105250
AA Change: H546R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000100885
Gene: ENSMUSG00000025404
AA Change: H546R

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.6e-12 PFAM
low complexity region 320 332 N/A INTRINSIC
low complexity region 412 443 N/A INTRINSIC
low complexity region 456 481 N/A INTRINSIC
low complexity region 726 757 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105251
AA Change: H546R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000100886
Gene: ENSMUSG00000025404
AA Change: H546R

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.6e-12 PFAM
low complexity region 320 332 N/A INTRINSIC
low complexity region 412 443 N/A INTRINSIC
low complexity region 456 481 N/A INTRINSIC
low complexity region 726 757 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164161
SMART Domains Protein: ENSMUSP00000126185
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164831
AA Change: H498R

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131007
Gene: ENSMUSG00000025404
AA Change: H498R

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
low complexity region 306 318 N/A INTRINSIC
low complexity region 398 429 N/A INTRINSIC
low complexity region 678 709 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166820
AA Change: H564R

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126608
Gene: ENSMUSG00000025404
AA Change: H564R

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.7e-12 PFAM
low complexity region 338 350 N/A INTRINSIC
low complexity region 430 461 N/A INTRINSIC
low complexity region 474 499 N/A INTRINSIC
low complexity region 744 775 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168079
SMART Domains Protein: ENSMUSP00000130506
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 43 63 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169888
AA Change: H263R

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126760
Gene: ENSMUSG00000025404
AA Change: H263R

DomainStartEndE-ValueType
Pfam:SUZ 7 54 4.7e-12 PFAM
low complexity region 71 83 N/A INTRINSIC
low complexity region 163 194 N/A INTRINSIC
low complexity region 443 474 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170336
AA Change: H532R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128659
Gene: ENSMUSG00000025404
AA Change: H532R

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
low complexity region 306 318 N/A INTRINSIC
low complexity region 398 429 N/A INTRINSIC
low complexity region 442 467 N/A INTRINSIC
low complexity region 712 743 N/A INTRINSIC
Meta Mutation Damage Score 0.0762 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 78,924,174 (GRCm39) S94L probably benign Het
Ackr1 C T 1: 173,159,755 (GRCm39) G255R probably damaging Het
Aldh1l2 G A 10: 83,337,785 (GRCm39) T560I probably damaging Het
Arhgef25 A T 10: 127,020,266 (GRCm39) F384I probably damaging Het
Bptf T A 11: 106,943,679 (GRCm39) Q2671L probably damaging Het
Ccdc159 A G 9: 21,844,223 (GRCm39) E95G probably damaging Het
Cenpf A T 1: 189,385,385 (GRCm39) H2298Q probably benign Het
Chn2 G T 6: 54,246,467 (GRCm39) probably null Het
Csnk1g1 T C 9: 65,909,555 (GRCm39) L224P probably damaging Het
Cyp2c54 T A 19: 40,058,708 (GRCm39) K241N probably benign Het
Cyp2c55 G T 19: 38,999,485 (GRCm39) V64L probably damaging Het
Dlgap1 A C 17: 70,823,967 (GRCm39) Q317H probably damaging Het
Dnaja3 A G 16: 4,505,212 (GRCm39) D108G probably null Het
Dpagt1 G T 9: 44,243,390 (GRCm39) probably null Het
Dzip1 T C 14: 119,138,958 (GRCm39) R424G possibly damaging Het
Ero1b A G 13: 12,616,672 (GRCm39) K367R probably benign Het
Evi2 T C 11: 79,406,891 (GRCm39) Y228C probably benign Het
Exosc10 A T 4: 148,649,847 (GRCm39) I426L possibly damaging Het
Gba2 C T 4: 43,569,944 (GRCm39) R423Q probably damaging Het
Gm19965 A C 1: 116,730,854 (GRCm39) probably benign Het
Gpr165 C A X: 95,757,623 (GRCm39) D7E probably benign Het
Gvin2 T C 7: 105,548,133 (GRCm39) K1640E possibly damaging Het
Hc A T 2: 34,879,182 (GRCm39) C1557S probably damaging Het
Hfm1 C T 5: 107,029,684 (GRCm39) S799N probably benign Het
Hibadh A T 6: 52,617,185 (GRCm39) W17R probably benign Het
Hivep1 A T 13: 42,337,696 (GRCm39) T2592S probably benign Het
Ighv8-5 G A 12: 115,031,200 (GRCm39) T113I probably benign Het
Il2rb A T 15: 78,370,006 (GRCm39) V211D probably damaging Het
Itgal A G 7: 126,900,105 (GRCm39) Y121C probably damaging Het
Kirrel1 T C 3: 86,992,138 (GRCm39) T597A possibly damaging Het
Lats1 A G 10: 7,581,279 (GRCm39) E688G probably damaging Het
Lbr C T 1: 181,644,539 (GRCm39) A589T possibly damaging Het
Limch1 G A 5: 67,131,908 (GRCm39) V133I probably benign Het
Mast2 C T 4: 116,164,407 (GRCm39) A1670T probably benign Het
Mtcl1 A T 17: 66,684,942 (GRCm39) L949Q probably benign Het
Nlrp4a T C 7: 26,159,219 (GRCm39) V833A probably benign Het
Or12k5 T C 2: 36,895,060 (GRCm39) T189A probably benign Het
Or8g28 A T 9: 39,169,099 (GRCm39) Y290N probably damaging Het
Osgep C A 14: 51,155,334 (GRCm39) A75S probably damaging Het
Pank1 C A 19: 34,856,055 (GRCm39) R141L probably benign Het
Pcdhb20 T A 18: 37,638,307 (GRCm39) S278T probably benign Het
Pcdhgb8 C A 18: 37,896,365 (GRCm39) F478L probably benign Het
Peg10 C CTCT 6: 4,756,453 (GRCm39) probably benign Het
Polr2a G A 11: 69,626,312 (GRCm39) P1613S probably benign Het
Pramel55 A C 5: 95,949,567 (GRCm39) M105L probably benign Het
Prom2 A C 2: 127,381,124 (GRCm39) S251A probably benign Het
Reck G T 4: 43,891,011 (GRCm39) V50L probably benign Het
Rerg T C 6: 137,033,184 (GRCm39) T164A probably benign Het
Rho T A 6: 115,912,346 (GRCm39) probably null Het
Ric1 A G 19: 29,575,183 (GRCm39) T959A probably damaging Het
Slc28a3 T A 13: 58,724,609 (GRCm39) N215I possibly damaging Het
Slc2a5 G A 4: 150,210,119 (GRCm39) V35I probably benign Het
Srpk2 A T 5: 23,718,986 (GRCm39) S610T probably benign Het
Tasor2 A G 13: 3,625,079 (GRCm39) F1624L probably benign Het
Tmem147 T A 7: 30,427,656 (GRCm39) M86L probably benign Het
Trhde A G 10: 114,636,622 (GRCm39) V195A probably benign Het
Trio T C 15: 27,774,038 (GRCm39) S112G possibly damaging Het
U2af2 T C 7: 5,078,693 (GRCm39) V424A probably benign Het
Vmn2r27 T C 6: 124,201,200 (GRCm39) I252M probably benign Het
Wasf2 A G 4: 132,912,412 (GRCm39) E88G unknown Het
Zfp37 A G 4: 62,110,240 (GRCm39) C275R probably damaging Het
Zfp532 A T 18: 65,757,137 (GRCm39) I357F probably damaging Het
Other mutations in R3hdm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:R3hdm2 APN 10 127,294,719 (GRCm39) missense probably damaging 1.00
IGL02114:R3hdm2 APN 10 127,319,978 (GRCm39) missense probably damaging 0.99
IGL02116:R3hdm2 APN 10 127,334,421 (GRCm39) missense probably damaging 1.00
IGL02549:R3hdm2 APN 10 127,320,094 (GRCm39) splice site probably benign
IGL02647:R3hdm2 APN 10 127,295,353 (GRCm39) missense probably damaging 1.00
IGL02696:R3hdm2 APN 10 127,300,888 (GRCm39) splice site probably null
IGL02732:R3hdm2 APN 10 127,319,929 (GRCm39) missense probably benign 0.43
R0131:R3hdm2 UTSW 10 127,334,322 (GRCm39) missense probably damaging 1.00
R0131:R3hdm2 UTSW 10 127,334,322 (GRCm39) missense probably damaging 1.00
R0132:R3hdm2 UTSW 10 127,334,322 (GRCm39) missense probably damaging 1.00
R0157:R3hdm2 UTSW 10 127,307,858 (GRCm39) missense probably damaging 0.99
R0179:R3hdm2 UTSW 10 127,330,975 (GRCm39) missense probably damaging 1.00
R0196:R3hdm2 UTSW 10 127,320,390 (GRCm39) missense probably damaging 1.00
R0401:R3hdm2 UTSW 10 127,294,042 (GRCm39) missense possibly damaging 0.90
R0505:R3hdm2 UTSW 10 127,293,569 (GRCm39) missense probably damaging 1.00
R0606:R3hdm2 UTSW 10 127,280,313 (GRCm39) missense probably damaging 1.00
R1188:R3hdm2 UTSW 10 127,288,624 (GRCm39) missense probably benign 0.02
R1466:R3hdm2 UTSW 10 127,312,559 (GRCm39) missense probably benign 0.01
R1466:R3hdm2 UTSW 10 127,312,559 (GRCm39) missense probably benign 0.01
R1503:R3hdm2 UTSW 10 127,307,695 (GRCm39) nonsense probably null
R1584:R3hdm2 UTSW 10 127,312,559 (GRCm39) missense probably benign 0.01
R1652:R3hdm2 UTSW 10 127,330,960 (GRCm39) missense probably benign 0.00
R1901:R3hdm2 UTSW 10 127,334,337 (GRCm39) missense possibly damaging 0.91
R3735:R3hdm2 UTSW 10 127,300,879 (GRCm39) missense probably benign
R5261:R3hdm2 UTSW 10 127,334,285 (GRCm39) missense probably damaging 1.00
R5329:R3hdm2 UTSW 10 127,294,762 (GRCm39) missense probably damaging 1.00
R5379:R3hdm2 UTSW 10 127,307,771 (GRCm39) missense probably damaging 1.00
R5380:R3hdm2 UTSW 10 127,321,316 (GRCm39) missense probably damaging 1.00
R5387:R3hdm2 UTSW 10 127,321,303 (GRCm39) missense probably damaging 1.00
R5558:R3hdm2 UTSW 10 127,280,271 (GRCm39) missense probably damaging 1.00
R5773:R3hdm2 UTSW 10 127,280,172 (GRCm39) utr 5 prime probably benign
R5936:R3hdm2 UTSW 10 127,307,681 (GRCm39) missense probably damaging 1.00
R6024:R3hdm2 UTSW 10 127,295,349 (GRCm39) missense probably damaging 1.00
R6160:R3hdm2 UTSW 10 127,320,376 (GRCm39) missense probably damaging 1.00
R6191:R3hdm2 UTSW 10 127,320,384 (GRCm39) missense probably damaging 1.00
R7058:R3hdm2 UTSW 10 127,320,382 (GRCm39) missense probably damaging 1.00
R7224:R3hdm2 UTSW 10 127,294,022 (GRCm39) missense probably damaging 1.00
R7253:R3hdm2 UTSW 10 127,317,644 (GRCm39) missense probably damaging 1.00
R7305:R3hdm2 UTSW 10 127,312,547 (GRCm39) missense probably benign 0.08
R7349:R3hdm2 UTSW 10 127,328,515 (GRCm39) missense probably benign
R7431:R3hdm2 UTSW 10 127,294,016 (GRCm39) missense probably benign 0.16
R7891:R3hdm2 UTSW 10 127,334,443 (GRCm39) missense probably benign 0.07
R8503:R3hdm2 UTSW 10 127,328,481 (GRCm39) missense possibly damaging 0.95
R8782:R3hdm2 UTSW 10 127,293,521 (GRCm39) missense probably damaging 1.00
R8783:R3hdm2 UTSW 10 127,293,521 (GRCm39) missense probably damaging 1.00
R8784:R3hdm2 UTSW 10 127,293,521 (GRCm39) missense probably damaging 1.00
R8787:R3hdm2 UTSW 10 127,293,521 (GRCm39) missense probably damaging 1.00
R8789:R3hdm2 UTSW 10 127,293,521 (GRCm39) missense probably damaging 1.00
R8790:R3hdm2 UTSW 10 127,293,521 (GRCm39) missense probably damaging 1.00
R9041:R3hdm2 UTSW 10 127,320,405 (GRCm39) missense probably damaging 1.00
R9198:R3hdm2 UTSW 10 127,293,521 (GRCm39) missense probably damaging 1.00
R9200:R3hdm2 UTSW 10 127,293,521 (GRCm39) missense probably damaging 1.00
R9202:R3hdm2 UTSW 10 127,293,521 (GRCm39) missense probably damaging 1.00
R9706:R3hdm2 UTSW 10 127,334,298 (GRCm39) missense probably benign 0.01
R9760:R3hdm2 UTSW 10 127,280,182 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CCTACTCTCTCAACAGGCAG -3'
(R):5'- TAAACCACCACTGCTGTGC -3'

Sequencing Primer
(F):5'- GAAGACCTCAGCAACCCCTTTG -3'
(R):5'- TGCTGTGCAGAAAGGAGACTG -3'
Posted On 2021-01-18