Incidental Mutation 'R8477:Fam208b'
ID657325
Institutional Source Beutler Lab
Gene Symbol Fam208b
Ensembl Gene ENSMUSG00000033799
Gene Namefamily with sequence similarity 208, member B
SynonymsBC016423
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R8477 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location3566035-3611108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3575079 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1624 (F1624L)
Ref Sequence ENSEMBL: ENSMUSP00000093774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096069]
Predicted Effect probably benign
Transcript: ENSMUST00000096069
AA Change: F1624L

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000093774
Gene: ENSMUSG00000033799
AA Change: F1624L

DomainStartEndE-ValueType
Pfam:DUF3699 91 167 1.4e-24 PFAM
low complexity region 272 282 N/A INTRINSIC
low complexity region 447 459 N/A INTRINSIC
Pfam:DUF3715 533 695 2.3e-25 PFAM
low complexity region 1156 1168 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 2012 2021 N/A INTRINSIC
low complexity region 2250 2263 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 79,088,340 S94L probably benign Het
Ackr1 C T 1: 173,332,188 G255R probably damaging Het
Aldh1l2 G A 10: 83,501,921 T560I probably damaging Het
Arhgef25 A T 10: 127,184,397 F384I probably damaging Het
Bptf T A 11: 107,052,853 Q2671L probably damaging Het
Ccdc159 A G 9: 21,932,927 E95G probably damaging Het
Cenpf A T 1: 189,653,188 H2298Q probably benign Het
Chn2 G T 6: 54,269,482 probably null Het
Csnk1g1 T C 9: 66,002,273 L224P probably damaging Het
Cyp2c54 T A 19: 40,070,264 K241N probably benign Het
Cyp2c55 G T 19: 39,011,041 V64L probably damaging Het
Dlgap1 A C 17: 70,516,972 Q317H probably damaging Het
Dnaja3 A G 16: 4,687,348 D108G probably null Het
Dpagt1 G T 9: 44,332,093 probably null Het
Dzip1 T C 14: 118,901,546 R424G possibly damaging Het
E330014E10Rik A C 5: 95,801,708 M105L probably benign Het
Ero1lb A G 13: 12,601,783 K367R probably benign Het
Evi2 T C 11: 79,516,065 Y228C probably benign Het
Exosc10 A T 4: 148,565,390 I426L possibly damaging Het
Gba2 C T 4: 43,569,944 R423Q probably damaging Het
Gm19965 A C 1: 116,803,124 probably benign Het
Gm4070 T C 7: 105,898,926 K1640E possibly damaging Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Hc A T 2: 34,989,170 C1557S probably damaging Het
Hfm1 C T 5: 106,881,818 S799N probably benign Het
Hibadh A T 6: 52,640,200 W17R probably benign Het
Hivep1 A T 13: 42,184,220 T2592S probably benign Het
Ighv8-5 G A 12: 115,067,580 T113I probably benign Het
Il2rb A T 15: 78,485,806 V211D probably damaging Het
Itgal A G 7: 127,300,933 Y121C probably damaging Het
Kirrel T C 3: 87,084,831 T597A possibly damaging Het
Lats1 A G 10: 7,705,515 E688G probably damaging Het
Lbr C T 1: 181,816,974 A589T possibly damaging Het
Limch1 G A 5: 66,974,565 V133I probably benign Het
Mast2 C T 4: 116,307,210 A1670T probably benign Het
Mtcl1 A T 17: 66,377,947 L949Q probably benign Het
Nlrp4a T C 7: 26,459,794 V833A probably benign Het
Olfr358 T C 2: 37,005,048 T189A probably benign Het
Olfr945 A T 9: 39,257,803 Y290N probably damaging Het
Osgep C A 14: 50,917,877 A75S probably damaging Het
Pank1 C A 19: 34,878,655 R141L probably benign Het
Pcdhb20 T A 18: 37,505,254 S278T probably benign Het
Pcdhgb8 C A 18: 37,763,312 F478L probably benign Het
Peg10 C CTCT 6: 4,756,453 probably benign Het
Polr2a G A 11: 69,735,486 P1613S probably benign Het
Prom2 A C 2: 127,539,204 S251A probably benign Het
R3hdm2 A G 10: 127,484,160 H546R probably damaging Het
Reck G T 4: 43,891,011 V50L probably benign Het
Rerg T C 6: 137,056,186 T164A probably benign Het
Rho T A 6: 115,935,385 probably null Het
Ric1 A G 19: 29,597,783 T959A probably damaging Het
Slc28a3 T A 13: 58,576,795 N215I possibly damaging Het
Slc2a5 G A 4: 150,125,662 V35I probably benign Het
Srpk2 A T 5: 23,513,988 S610T probably benign Het
Tmem147 T A 7: 30,728,231 M86L probably benign Het
Trhde A G 10: 114,800,717 V195A probably benign Het
Trio T C 15: 27,773,952 S112G possibly damaging Het
U2af2 T C 7: 5,075,694 V424A probably benign Het
Vmn2r27 T C 6: 124,224,241 I252M probably benign Het
Wasf2 A G 4: 133,185,101 E88G unknown Het
Zfp37 A G 4: 62,192,003 C275R probably damaging Het
Zfp532 A T 18: 65,624,066 I357F probably damaging Het
Other mutations in Fam208b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Fam208b APN 13 3574832 missense probably benign
IGL00670:Fam208b APN 13 3585241 missense probably benign 0.14
IGL00957:Fam208b APN 13 3577101 missense possibly damaging 0.86
IGL01311:Fam208b APN 13 3575885 missense possibly damaging 0.85
IGL01318:Fam208b APN 13 3575067 missense possibly damaging 0.66
IGL01767:Fam208b APN 13 3576633 missense probably benign 0.00
IGL02073:Fam208b APN 13 3574721 missense probably benign 0.01
IGL02152:Fam208b APN 13 3585371 missense probably benign
IGL02431:Fam208b APN 13 3574736 missense possibly damaging 0.85
IGL02478:Fam208b APN 13 3574661 missense probably benign 0.12
IGL02732:Fam208b APN 13 3573626 missense probably benign 0.09
IGL02745:Fam208b APN 13 3585140 missense probably benign 0.23
IGL02800:Fam208b APN 13 3585154 missense probably benign
IGL02989:Fam208b APN 13 3584820 missense probably benign 0.01
IGL03124:Fam208b APN 13 3574704 missense probably benign 0.41
IGL03154:Fam208b APN 13 3575255 missense possibly damaging 0.56
IGL03216:Fam208b APN 13 3574553 missense probably damaging 0.98
BB001:Fam208b UTSW 13 3594331 missense possibly damaging 0.92
BB011:Fam208b UTSW 13 3594331 missense possibly damaging 0.92
H8562:Fam208b UTSW 13 3577000 missense probably damaging 0.98
PIT4585001:Fam208b UTSW 13 3574979 missense possibly damaging 0.55
R0016:Fam208b UTSW 13 3585170 splice site probably null
R0016:Fam208b UTSW 13 3585170 splice site probably null
R0157:Fam208b UTSW 13 3575550 missense probably benign 0.06
R0375:Fam208b UTSW 13 3596842 missense possibly damaging 0.85
R0403:Fam208b UTSW 13 3582052 nonsense probably null
R0472:Fam208b UTSW 13 3588364 missense possibly damaging 0.93
R0517:Fam208b UTSW 13 3566964 missense possibly damaging 0.94
R0586:Fam208b UTSW 13 3590321 missense probably damaging 0.99
R0600:Fam208b UTSW 13 3576054 missense probably benign
R0659:Fam208b UTSW 13 3574448 missense probably damaging 0.99
R1257:Fam208b UTSW 13 3575049 missense probably benign 0.25
R1375:Fam208b UTSW 13 3576029 missense probably benign 0.06
R1443:Fam208b UTSW 13 3575543 missense probably benign 0.00
R1497:Fam208b UTSW 13 3570409 missense probably damaging 0.96
R1544:Fam208b UTSW 13 3590413 missense possibly damaging 0.68
R1554:Fam208b UTSW 13 3576374 missense possibly damaging 0.85
R1629:Fam208b UTSW 13 3574121 missense possibly damaging 0.84
R1633:Fam208b UTSW 13 3581771 missense possibly damaging 0.53
R1661:Fam208b UTSW 13 3573860 missense possibly damaging 0.63
R1673:Fam208b UTSW 13 3584498 critical splice donor site probably null
R1675:Fam208b UTSW 13 3569507 missense possibly damaging 0.65
R1781:Fam208b UTSW 13 3584759 missense possibly damaging 0.95
R1792:Fam208b UTSW 13 3590559 missense possibly damaging 0.91
R1826:Fam208b UTSW 13 3581759 missense probably damaging 0.98
R1920:Fam208b UTSW 13 3576612 missense possibly damaging 0.63
R1983:Fam208b UTSW 13 3574853 missense possibly damaging 0.92
R2016:Fam208b UTSW 13 3576770 missense probably benign 0.41
R2017:Fam208b UTSW 13 3576770 missense probably benign 0.41
R2220:Fam208b UTSW 13 3581872 missense probably benign 0.00
R2513:Fam208b UTSW 13 3582150 missense possibly damaging 0.53
R2898:Fam208b UTSW 13 3585122 missense possibly damaging 0.82
R2904:Fam208b UTSW 13 3582185 missense possibly damaging 0.53
R3149:Fam208b UTSW 13 3574359 missense probably damaging 0.98
R3623:Fam208b UTSW 13 3595556 missense probably benign
R3624:Fam208b UTSW 13 3595556 missense probably benign
R3725:Fam208b UTSW 13 3590538 missense probably benign 0.33
R3835:Fam208b UTSW 13 3575292 missense probably benign 0.01
R3890:Fam208b UTSW 13 3596785 missense probably damaging 0.96
R4023:Fam208b UTSW 13 3584554 missense probably damaging 0.99
R4024:Fam208b UTSW 13 3584554 missense probably damaging 0.99
R4025:Fam208b UTSW 13 3584554 missense probably damaging 0.99
R4050:Fam208b UTSW 13 3573507 missense probably benign 0.09
R4308:Fam208b UTSW 13 3569498 missense probably damaging 0.97
R4484:Fam208b UTSW 13 3581831 missense probably benign 0.12
R4674:Fam208b UTSW 13 3573686 missense possibly damaging 0.69
R4718:Fam208b UTSW 13 3574495 missense probably benign 0.00
R4745:Fam208b UTSW 13 3590069 missense probably benign 0.26
R4776:Fam208b UTSW 13 3570391 missense probably damaging 1.00
R4839:Fam208b UTSW 13 3584807 missense probably damaging 0.96
R4855:Fam208b UTSW 13 3566680 splice site probably null
R5049:Fam208b UTSW 13 3574000 missense probably benign 0.00
R5076:Fam208b UTSW 13 3576357 missense probably benign 0.41
R5287:Fam208b UTSW 13 3575744 missense probably benign 0.41
R5298:Fam208b UTSW 13 3595613 splice site probably null
R5379:Fam208b UTSW 13 3588496 missense probably benign 0.41
R5512:Fam208b UTSW 13 3595517 missense probably damaging 0.99
R5624:Fam208b UTSW 13 3584996 missense possibly damaging 0.66
R5750:Fam208b UTSW 13 3573642 nonsense probably null
R6114:Fam208b UTSW 13 3590081 missense probably damaging 1.00
R6118:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6119:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6269:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6270:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6271:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6272:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6525:Fam208b UTSW 13 3576540 nonsense probably null
R6550:Fam208b UTSW 13 3590519 missense possibly damaging 0.85
R6714:Fam208b UTSW 13 3594189 missense probably benign 0.00
R6797:Fam208b UTSW 13 3576769 missense probably benign 0.26
R6967:Fam208b UTSW 13 3574819 missense probably benign 0.22
R7016:Fam208b UTSW 13 3576857 missense possibly damaging 0.92
R7219:Fam208b UTSW 13 3590521 missense probably damaging 0.99
R7454:Fam208b UTSW 13 3585332 missense probably benign 0.21
R7570:Fam208b UTSW 13 3573621 missense probably damaging 0.99
R7571:Fam208b UTSW 13 3575292 missense probably benign 0.01
R7580:Fam208b UTSW 13 3574752 missense probably damaging 0.99
R7587:Fam208b UTSW 13 3568849 missense possibly damaging 0.83
R7657:Fam208b UTSW 13 3573777 missense probably damaging 0.98
R7810:Fam208b UTSW 13 3575714 missense possibly damaging 0.61
R7909:Fam208b UTSW 13 3573765 missense possibly damaging 0.93
R7924:Fam208b UTSW 13 3594331 missense possibly damaging 0.92
R7945:Fam208b UTSW 13 3576085 missense probably benign
R8005:Fam208b UTSW 13 3575681 missense probably benign
R8067:Fam208b UTSW 13 3569602 missense probably benign
R8112:Fam208b UTSW 13 3569516 missense probably damaging 1.00
R8162:Fam208b UTSW 13 3599691 missense probably damaging 0.96
R8170:Fam208b UTSW 13 3574881 nonsense probably null
R8240:Fam208b UTSW 13 3574388 missense probably benign
R8263:Fam208b UTSW 13 3575286 missense possibly damaging 0.70
R8263:Fam208b UTSW 13 3590016 missense probably benign 0.03
X0024:Fam208b UTSW 13 3599837 missense probably null 0.99
X0025:Fam208b UTSW 13 3576827 missense probably benign 0.15
X0066:Fam208b UTSW 13 3588441 missense probably benign 0.04
Z1176:Fam208b UTSW 13 3576636 missense probably benign 0.01
Z1176:Fam208b UTSW 13 3588429 missense probably damaging 0.98
Z1177:Fam208b UTSW 13 3574234 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTGCAGACATGGAGTTAGACTG -3'
(R):5'- GGCCTTGGAGTCTAGTGTAC -3'

Sequencing Primer
(F):5'- ACATGGAGTTAGACTGAAGTCC -3'
(R):5'- GAGTCTAGTGTACCTTCATGTAGTCC -3'
Posted On2021-01-18