Incidental Mutation 'R8477:Dzip1'
ID 657330
Institutional Source Beutler Lab
Gene Symbol Dzip1
Ensembl Gene ENSMUSG00000042156
Gene Name DAZ interacting protein 1
Synonyms 2510025K24Rik, 2810422M04Rik
MMRRC Submission 067921-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.326) question?
Stock # R8477 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 119112932-119162872 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119138958 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 424 (R424G)
Ref Sequence ENSEMBL: ENSMUSP00000039689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004055] [ENSMUST00000047208]
AlphaFold Q8BMD2
Predicted Effect possibly damaging
Transcript: ENSMUST00000004055
AA Change: R424G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000004055
Gene: ENSMUSG00000042156
AA Change: R424G

DomainStartEndE-ValueType
Pfam:Dzip-like_N 43 163 3.6e-45 PFAM
ZnF_C2H2 183 206 2.09e-3 SMART
coiled coil region 214 249 N/A INTRINSIC
coiled coil region 276 303 N/A INTRINSIC
coiled coil region 385 427 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
low complexity region 481 496 N/A INTRINSIC
low complexity region 661 673 N/A INTRINSIC
low complexity region 781 795 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000047208
AA Change: R424G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000039689
Gene: ENSMUSG00000042156
AA Change: R424G

DomainStartEndE-ValueType
Pfam:Dzip-like_N 43 163 3.7e-46 PFAM
ZnF_C2H2 183 206 2.09e-3 SMART
coiled coil region 214 249 N/A INTRINSIC
coiled coil region 276 303 N/A INTRINSIC
coiled coil region 385 427 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
low complexity region 481 496 N/A INTRINSIC
low complexity region 661 673 N/A INTRINSIC
low complexity region 781 795 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: This gene encodes a zinc finger protein that has been demonstrated to interact with the deleted in azoospermia (DAZ) protein. DAZ plays an important role early in germ cell development to maintain the initial germ cell population. Deletion of this gene in mice compromises Hedgehog signaling during embryogenesis. Mouse embryos lacking the encoded protein show severe developmental defects with dorsalized neural tubes and underdeveloped somites. Alternative splicing of this gene results in multiple transcript variants. A pseudogene for this gene has been identified on chromosome 5. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a targeted allele lacking exons 2 and 3 exhibit partial embryonic lethality around E9.5, decreased embryo size, underdevelopment of the neural tube and somite and lack of primary cilia on MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 78,924,174 (GRCm39) S94L probably benign Het
Ackr1 C T 1: 173,159,755 (GRCm39) G255R probably damaging Het
Aldh1l2 G A 10: 83,337,785 (GRCm39) T560I probably damaging Het
Arhgef25 A T 10: 127,020,266 (GRCm39) F384I probably damaging Het
Bptf T A 11: 106,943,679 (GRCm39) Q2671L probably damaging Het
Ccdc159 A G 9: 21,844,223 (GRCm39) E95G probably damaging Het
Cenpf A T 1: 189,385,385 (GRCm39) H2298Q probably benign Het
Chn2 G T 6: 54,246,467 (GRCm39) probably null Het
Csnk1g1 T C 9: 65,909,555 (GRCm39) L224P probably damaging Het
Cyp2c54 T A 19: 40,058,708 (GRCm39) K241N probably benign Het
Cyp2c55 G T 19: 38,999,485 (GRCm39) V64L probably damaging Het
Dlgap1 A C 17: 70,823,967 (GRCm39) Q317H probably damaging Het
Dnaja3 A G 16: 4,505,212 (GRCm39) D108G probably null Het
Dpagt1 G T 9: 44,243,390 (GRCm39) probably null Het
Ero1b A G 13: 12,616,672 (GRCm39) K367R probably benign Het
Evi2 T C 11: 79,406,891 (GRCm39) Y228C probably benign Het
Exosc10 A T 4: 148,649,847 (GRCm39) I426L possibly damaging Het
Gba2 C T 4: 43,569,944 (GRCm39) R423Q probably damaging Het
Gm19965 A C 1: 116,730,854 (GRCm39) probably benign Het
Gpr165 C A X: 95,757,623 (GRCm39) D7E probably benign Het
Gvin2 T C 7: 105,548,133 (GRCm39) K1640E possibly damaging Het
Hc A T 2: 34,879,182 (GRCm39) C1557S probably damaging Het
Hfm1 C T 5: 107,029,684 (GRCm39) S799N probably benign Het
Hibadh A T 6: 52,617,185 (GRCm39) W17R probably benign Het
Hivep1 A T 13: 42,337,696 (GRCm39) T2592S probably benign Het
Ighv8-5 G A 12: 115,031,200 (GRCm39) T113I probably benign Het
Il2rb A T 15: 78,370,006 (GRCm39) V211D probably damaging Het
Itgal A G 7: 126,900,105 (GRCm39) Y121C probably damaging Het
Kirrel1 T C 3: 86,992,138 (GRCm39) T597A possibly damaging Het
Lats1 A G 10: 7,581,279 (GRCm39) E688G probably damaging Het
Lbr C T 1: 181,644,539 (GRCm39) A589T possibly damaging Het
Limch1 G A 5: 67,131,908 (GRCm39) V133I probably benign Het
Mast2 C T 4: 116,164,407 (GRCm39) A1670T probably benign Het
Mtcl1 A T 17: 66,684,942 (GRCm39) L949Q probably benign Het
Nlrp4a T C 7: 26,159,219 (GRCm39) V833A probably benign Het
Or12k5 T C 2: 36,895,060 (GRCm39) T189A probably benign Het
Or8g28 A T 9: 39,169,099 (GRCm39) Y290N probably damaging Het
Osgep C A 14: 51,155,334 (GRCm39) A75S probably damaging Het
Pank1 C A 19: 34,856,055 (GRCm39) R141L probably benign Het
Pcdhb20 T A 18: 37,638,307 (GRCm39) S278T probably benign Het
Pcdhgb8 C A 18: 37,896,365 (GRCm39) F478L probably benign Het
Peg10 C CTCT 6: 4,756,453 (GRCm39) probably benign Het
Polr2a G A 11: 69,626,312 (GRCm39) P1613S probably benign Het
Pramel55 A C 5: 95,949,567 (GRCm39) M105L probably benign Het
Prom2 A C 2: 127,381,124 (GRCm39) S251A probably benign Het
R3hdm2 A G 10: 127,320,029 (GRCm39) H546R probably damaging Het
Reck G T 4: 43,891,011 (GRCm39) V50L probably benign Het
Rerg T C 6: 137,033,184 (GRCm39) T164A probably benign Het
Rho T A 6: 115,912,346 (GRCm39) probably null Het
Ric1 A G 19: 29,575,183 (GRCm39) T959A probably damaging Het
Slc28a3 T A 13: 58,724,609 (GRCm39) N215I possibly damaging Het
Slc2a5 G A 4: 150,210,119 (GRCm39) V35I probably benign Het
Srpk2 A T 5: 23,718,986 (GRCm39) S610T probably benign Het
Tasor2 A G 13: 3,625,079 (GRCm39) F1624L probably benign Het
Tmem147 T A 7: 30,427,656 (GRCm39) M86L probably benign Het
Trhde A G 10: 114,636,622 (GRCm39) V195A probably benign Het
Trio T C 15: 27,774,038 (GRCm39) S112G possibly damaging Het
U2af2 T C 7: 5,078,693 (GRCm39) V424A probably benign Het
Vmn2r27 T C 6: 124,201,200 (GRCm39) I252M probably benign Het
Wasf2 A G 4: 132,912,412 (GRCm39) E88G unknown Het
Zfp37 A G 4: 62,110,240 (GRCm39) C275R probably damaging Het
Zfp532 A T 18: 65,757,137 (GRCm39) I357F probably damaging Het
Other mutations in Dzip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dzip1 APN 14 119,120,806 (GRCm39) missense probably benign 0.41
IGL01534:Dzip1 APN 14 119,114,651 (GRCm39) missense probably damaging 1.00
IGL01617:Dzip1 APN 14 119,118,477 (GRCm39) missense probably benign 0.16
IGL02537:Dzip1 APN 14 119,146,988 (GRCm39) splice site probably benign
IGL02801:Dzip1 APN 14 119,123,067 (GRCm39) nonsense probably null
IGL03354:Dzip1 APN 14 119,149,981 (GRCm39) splice site probably benign
BB003:Dzip1 UTSW 14 119,120,911 (GRCm39) missense probably benign 0.00
BB013:Dzip1 UTSW 14 119,120,911 (GRCm39) missense probably benign 0.00
PIT4151001:Dzip1 UTSW 14 119,160,200 (GRCm39) missense probably damaging 1.00
R0325:Dzip1 UTSW 14 119,146,969 (GRCm39) missense probably damaging 0.99
R0357:Dzip1 UTSW 14 119,146,950 (GRCm39) missense probably damaging 0.99
R0592:Dzip1 UTSW 14 119,139,551 (GRCm39) missense probably damaging 1.00
R0942:Dzip1 UTSW 14 119,124,609 (GRCm39) nonsense probably null
R1110:Dzip1 UTSW 14 119,126,717 (GRCm39) missense probably benign 0.15
R1458:Dzip1 UTSW 14 119,160,125 (GRCm39) missense probably benign 0.16
R1541:Dzip1 UTSW 14 119,116,890 (GRCm39) missense probably damaging 1.00
R2046:Dzip1 UTSW 14 119,159,890 (GRCm39) missense probably damaging 1.00
R2178:Dzip1 UTSW 14 119,126,816 (GRCm39) splice site probably null
R2316:Dzip1 UTSW 14 119,138,952 (GRCm39) missense probably benign 0.01
R2504:Dzip1 UTSW 14 119,118,456 (GRCm39) missense probably benign 0.11
R2851:Dzip1 UTSW 14 119,159,857 (GRCm39) missense possibly damaging 0.71
R2852:Dzip1 UTSW 14 119,159,857 (GRCm39) missense possibly damaging 0.71
R3149:Dzip1 UTSW 14 119,148,780 (GRCm39) missense probably benign 0.38
R4111:Dzip1 UTSW 14 119,114,645 (GRCm39) nonsense probably null
R4349:Dzip1 UTSW 14 119,120,938 (GRCm39) missense probably benign 0.00
R4350:Dzip1 UTSW 14 119,120,938 (GRCm39) missense probably benign 0.00
R4351:Dzip1 UTSW 14 119,120,938 (GRCm39) missense probably benign 0.00
R4352:Dzip1 UTSW 14 119,120,938 (GRCm39) missense probably benign 0.00
R4868:Dzip1 UTSW 14 119,114,626 (GRCm39) missense probably damaging 1.00
R5172:Dzip1 UTSW 14 119,124,563 (GRCm39) missense probably damaging 0.97
R5191:Dzip1 UTSW 14 119,148,805 (GRCm39) missense probably damaging 1.00
R5192:Dzip1 UTSW 14 119,148,805 (GRCm39) missense probably damaging 1.00
R5376:Dzip1 UTSW 14 119,148,805 (GRCm39) missense probably damaging 1.00
R5378:Dzip1 UTSW 14 119,148,805 (GRCm39) missense probably damaging 1.00
R5655:Dzip1 UTSW 14 119,124,644 (GRCm39) critical splice acceptor site probably null
R5816:Dzip1 UTSW 14 119,146,892 (GRCm39) missense probably benign 0.00
R7256:Dzip1 UTSW 14 119,123,058 (GRCm39) missense probably benign 0.00
R7768:Dzip1 UTSW 14 119,116,910 (GRCm39) missense probably benign 0.11
R7788:Dzip1 UTSW 14 119,120,805 (GRCm39) missense probably benign 0.00
R7926:Dzip1 UTSW 14 119,120,911 (GRCm39) missense probably benign 0.00
R8816:Dzip1 UTSW 14 119,159,785 (GRCm39) missense probably benign
R8933:Dzip1 UTSW 14 119,144,326 (GRCm39) missense probably damaging 0.98
R9233:Dzip1 UTSW 14 119,124,635 (GRCm39) missense probably benign
R9458:Dzip1 UTSW 14 119,148,785 (GRCm39) missense probably damaging 0.96
R9781:Dzip1 UTSW 14 119,148,834 (GRCm39) missense probably benign 0.35
X0009:Dzip1 UTSW 14 119,114,626 (GRCm39) missense probably damaging 0.98
X0026:Dzip1 UTSW 14 119,159,869 (GRCm39) missense probably damaging 1.00
Z1177:Dzip1 UTSW 14 119,148,788 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACTTTCTGGATTATGGGGAAAAC -3'
(R):5'- TGATCACCTGGAGAAGCAGC -3'

Sequencing Primer
(F):5'- TTCTGGATTATGGGGAAAACAAAAAC -3'
(R):5'- CAGCCTGATGCCTATGTGTGAC -3'
Posted On 2021-01-18