Incidental Mutation 'R8477:Il2rb'
ID 657332
Institutional Source Beutler Lab
Gene Symbol Il2rb
Ensembl Gene ENSMUSG00000068227
Gene Name interleukin 2 receptor, beta chain
Synonyms IL-15Rbeta, IL-15 receptor beta chain, IL-2/15Rbeta, IL15Rbeta, Il-2Rbeta, CD122
MMRRC Submission 067921-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.086) question?
Stock # R8477 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 78363456-78379471 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 78370006 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 211 (V211D)
Ref Sequence ENSEMBL: ENSMUSP00000127006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089398] [ENSMUST00000163494]
AlphaFold P16297
Predicted Effect probably damaging
Transcript: ENSMUST00000089398
AA Change: V211D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086820
Gene: ENSMUSG00000068227
AA Change: V211D

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
FN3 133 219 9.48e-3 SMART
transmembrane domain 246 268 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163494
AA Change: V211D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127006
Gene: ENSMUSG00000068227
AA Change: V211D

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
FN3 133 219 9.48e-3 SMART
transmembrane domain 246 268 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Meta Mutation Damage Score 0.6621 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: The interleukin 2 receptor is composed of alpha and beta subunits. The beta subunit encoded by this gene is very homologous to the human beta subunit and also shows structural similarity to other cytokine receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous activation of T cells and differentiation of B cells, elevated immunoglobulins including autoantibodies causing hemolytic anemia, granulocytopoiesis, and death after 3 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 78,924,174 (GRCm39) S94L probably benign Het
Ackr1 C T 1: 173,159,755 (GRCm39) G255R probably damaging Het
Aldh1l2 G A 10: 83,337,785 (GRCm39) T560I probably damaging Het
Arhgef25 A T 10: 127,020,266 (GRCm39) F384I probably damaging Het
Bptf T A 11: 106,943,679 (GRCm39) Q2671L probably damaging Het
Ccdc159 A G 9: 21,844,223 (GRCm39) E95G probably damaging Het
Cenpf A T 1: 189,385,385 (GRCm39) H2298Q probably benign Het
Chn2 G T 6: 54,246,467 (GRCm39) probably null Het
Csnk1g1 T C 9: 65,909,555 (GRCm39) L224P probably damaging Het
Cyp2c54 T A 19: 40,058,708 (GRCm39) K241N probably benign Het
Cyp2c55 G T 19: 38,999,485 (GRCm39) V64L probably damaging Het
Dlgap1 A C 17: 70,823,967 (GRCm39) Q317H probably damaging Het
Dnaja3 A G 16: 4,505,212 (GRCm39) D108G probably null Het
Dpagt1 G T 9: 44,243,390 (GRCm39) probably null Het
Dzip1 T C 14: 119,138,958 (GRCm39) R424G possibly damaging Het
Ero1b A G 13: 12,616,672 (GRCm39) K367R probably benign Het
Evi2 T C 11: 79,406,891 (GRCm39) Y228C probably benign Het
Exosc10 A T 4: 148,649,847 (GRCm39) I426L possibly damaging Het
Gba2 C T 4: 43,569,944 (GRCm39) R423Q probably damaging Het
Gm19965 A C 1: 116,730,854 (GRCm39) probably benign Het
Gpr165 C A X: 95,757,623 (GRCm39) D7E probably benign Het
Gvin2 T C 7: 105,548,133 (GRCm39) K1640E possibly damaging Het
Hc A T 2: 34,879,182 (GRCm39) C1557S probably damaging Het
Hfm1 C T 5: 107,029,684 (GRCm39) S799N probably benign Het
Hibadh A T 6: 52,617,185 (GRCm39) W17R probably benign Het
Hivep1 A T 13: 42,337,696 (GRCm39) T2592S probably benign Het
Ighv8-5 G A 12: 115,031,200 (GRCm39) T113I probably benign Het
Itgal A G 7: 126,900,105 (GRCm39) Y121C probably damaging Het
Kirrel1 T C 3: 86,992,138 (GRCm39) T597A possibly damaging Het
Lats1 A G 10: 7,581,279 (GRCm39) E688G probably damaging Het
Lbr C T 1: 181,644,539 (GRCm39) A589T possibly damaging Het
Limch1 G A 5: 67,131,908 (GRCm39) V133I probably benign Het
Mast2 C T 4: 116,164,407 (GRCm39) A1670T probably benign Het
Mtcl1 A T 17: 66,684,942 (GRCm39) L949Q probably benign Het
Nlrp4a T C 7: 26,159,219 (GRCm39) V833A probably benign Het
Or12k5 T C 2: 36,895,060 (GRCm39) T189A probably benign Het
Or8g28 A T 9: 39,169,099 (GRCm39) Y290N probably damaging Het
Osgep C A 14: 51,155,334 (GRCm39) A75S probably damaging Het
Pank1 C A 19: 34,856,055 (GRCm39) R141L probably benign Het
Pcdhb20 T A 18: 37,638,307 (GRCm39) S278T probably benign Het
Pcdhgb8 C A 18: 37,896,365 (GRCm39) F478L probably benign Het
Peg10 C CTCT 6: 4,756,453 (GRCm39) probably benign Het
Polr2a G A 11: 69,626,312 (GRCm39) P1613S probably benign Het
Pramel55 A C 5: 95,949,567 (GRCm39) M105L probably benign Het
Prom2 A C 2: 127,381,124 (GRCm39) S251A probably benign Het
R3hdm2 A G 10: 127,320,029 (GRCm39) H546R probably damaging Het
Reck G T 4: 43,891,011 (GRCm39) V50L probably benign Het
Rerg T C 6: 137,033,184 (GRCm39) T164A probably benign Het
Rho T A 6: 115,912,346 (GRCm39) probably null Het
Ric1 A G 19: 29,575,183 (GRCm39) T959A probably damaging Het
Slc28a3 T A 13: 58,724,609 (GRCm39) N215I possibly damaging Het
Slc2a5 G A 4: 150,210,119 (GRCm39) V35I probably benign Het
Srpk2 A T 5: 23,718,986 (GRCm39) S610T probably benign Het
Tasor2 A G 13: 3,625,079 (GRCm39) F1624L probably benign Het
Tmem147 T A 7: 30,427,656 (GRCm39) M86L probably benign Het
Trhde A G 10: 114,636,622 (GRCm39) V195A probably benign Het
Trio T C 15: 27,774,038 (GRCm39) S112G possibly damaging Het
U2af2 T C 7: 5,078,693 (GRCm39) V424A probably benign Het
Vmn2r27 T C 6: 124,201,200 (GRCm39) I252M probably benign Het
Wasf2 A G 4: 132,912,412 (GRCm39) E88G unknown Het
Zfp37 A G 4: 62,110,240 (GRCm39) C275R probably damaging Het
Zfp532 A T 18: 65,757,137 (GRCm39) I357F probably damaging Het
Other mutations in Il2rb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Il2rb APN 15 78,365,897 (GRCm39) missense probably benign 0.00
Bonnerhall UTSW 15 78,369,204 (GRCm39) missense probably benign
diptera UTSW 15 78,370,006 (GRCm39) missense probably damaging 1.00
flybase UTSW 15 78,376,048 (GRCm39) start codon destroyed probably null 0.66
Halfmeasure UTSW 15 78,370,681 (GRCm39) missense probably benign 0.04
Moonpie UTSW 15 78,366,034 (GRCm39) frame shift probably null
tetragonal UTSW 15 78,369,953 (GRCm39) missense probably benign
Whistles UTSW 15 78,366,136 (GRCm39) missense possibly damaging 0.72
R0581:Il2rb UTSW 15 78,366,136 (GRCm39) missense possibly damaging 0.72
R1795:Il2rb UTSW 15 78,368,187 (GRCm39) missense probably damaging 1.00
R1932:Il2rb UTSW 15 78,375,977 (GRCm39) missense possibly damaging 0.93
R2924:Il2rb UTSW 15 78,376,049 (GRCm39) start codon destroyed probably null 0.27
R4706:Il2rb UTSW 15 78,370,600 (GRCm39) missense possibly damaging 0.81
R5713:Il2rb UTSW 15 78,376,048 (GRCm39) start codon destroyed probably null 0.66
R5953:Il2rb UTSW 15 78,369,182 (GRCm39) nonsense probably null
R6018:Il2rb UTSW 15 78,366,266 (GRCm39) missense possibly damaging 0.54
R6279:Il2rb UTSW 15 78,365,738 (GRCm39) missense possibly damaging 0.72
R6666:Il2rb UTSW 15 78,366,034 (GRCm39) frame shift probably null
R6961:Il2rb UTSW 15 78,370,024 (GRCm39) missense probably damaging 1.00
R8020:Il2rb UTSW 15 78,369,204 (GRCm39) missense probably benign
R8854:Il2rb UTSW 15 78,369,953 (GRCm39) missense probably benign
R8976:Il2rb UTSW 15 78,370,681 (GRCm39) missense probably benign 0.04
R8979:Il2rb UTSW 15 78,376,052 (GRCm39) start gained probably benign
R9509:Il2rb UTSW 15 78,374,416 (GRCm39) missense probably damaging 0.97
R9541:Il2rb UTSW 15 78,372,393 (GRCm39) missense probably benign 0.00
R9745:Il2rb UTSW 15 78,372,399 (GRCm39) missense probably benign 0.00
X0018:Il2rb UTSW 15 78,369,965 (GRCm39) missense probably damaging 1.00
X0066:Il2rb UTSW 15 78,369,156 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACTGATGTCTTGAGCATCCC -3'
(R):5'- GAAGAGGCTGTTTGCTTAGC -3'

Sequencing Primer
(F):5'- GAGCATCCCTGTCTCTGGTAAG -3'
(R):5'- AGCCTCTTGACCTCGTTGCG -3'
Posted On 2021-01-18