Incidental Mutation 'R8477:Il2rb'
ID657332
Institutional Source Beutler Lab
Gene Symbol Il2rb
Ensembl Gene ENSMUSG00000068227
Gene Nameinterleukin 2 receptor, beta chain
SynonymsIL-15 receptor beta chain, CD122, IL-15Rbeta, IL15Rbeta, IL-2/15Rbeta, Il-2Rbeta
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R8477 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location78479256-78495271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78485806 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 211 (V211D)
Ref Sequence ENSEMBL: ENSMUSP00000127006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089398] [ENSMUST00000163494]
Predicted Effect probably damaging
Transcript: ENSMUST00000089398
AA Change: V211D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086820
Gene: ENSMUSG00000068227
AA Change: V211D

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
FN3 133 219 9.48e-3 SMART
transmembrane domain 246 268 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163494
AA Change: V211D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127006
Gene: ENSMUSG00000068227
AA Change: V211D

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
FN3 133 219 9.48e-3 SMART
transmembrane domain 246 268 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Meta Mutation Damage Score 0.6621 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: The interleukin 2 receptor is composed of alpha and beta subunits. The beta subunit encoded by this gene is very homologous to the human beta subunit and also shows structural similarity to other cytokine receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous activation of T cells and differentiation of B cells, elevated immunoglobulins including autoantibodies causing hemolytic anemia, granulocytopoiesis, and death after 3 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 79,088,340 S94L probably benign Het
Ackr1 C T 1: 173,332,188 G255R probably damaging Het
Aldh1l2 G A 10: 83,501,921 T560I probably damaging Het
Arhgef25 A T 10: 127,184,397 F384I probably damaging Het
Bptf T A 11: 107,052,853 Q2671L probably damaging Het
Ccdc159 A G 9: 21,932,927 E95G probably damaging Het
Cenpf A T 1: 189,653,188 H2298Q probably benign Het
Chn2 G T 6: 54,269,482 probably null Het
Csnk1g1 T C 9: 66,002,273 L224P probably damaging Het
Cyp2c54 T A 19: 40,070,264 K241N probably benign Het
Cyp2c55 G T 19: 39,011,041 V64L probably damaging Het
Dlgap1 A C 17: 70,516,972 Q317H probably damaging Het
Dnaja3 A G 16: 4,687,348 D108G probably null Het
Dpagt1 G T 9: 44,332,093 probably null Het
Dzip1 T C 14: 118,901,546 R424G possibly damaging Het
E330014E10Rik A C 5: 95,801,708 M105L probably benign Het
Ero1lb A G 13: 12,601,783 K367R probably benign Het
Evi2 T C 11: 79,516,065 Y228C probably benign Het
Exosc10 A T 4: 148,565,390 I426L possibly damaging Het
Fam208b A G 13: 3,575,079 F1624L probably benign Het
Gba2 C T 4: 43,569,944 R423Q probably damaging Het
Gm19965 A C 1: 116,803,124 probably benign Het
Gm4070 T C 7: 105,898,926 K1640E possibly damaging Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Hc A T 2: 34,989,170 C1557S probably damaging Het
Hfm1 C T 5: 106,881,818 S799N probably benign Het
Hibadh A T 6: 52,640,200 W17R probably benign Het
Hivep1 A T 13: 42,184,220 T2592S probably benign Het
Ighv8-5 G A 12: 115,067,580 T113I probably benign Het
Itgal A G 7: 127,300,933 Y121C probably damaging Het
Kirrel T C 3: 87,084,831 T597A possibly damaging Het
Lats1 A G 10: 7,705,515 E688G probably damaging Het
Lbr C T 1: 181,816,974 A589T possibly damaging Het
Limch1 G A 5: 66,974,565 V133I probably benign Het
Mast2 C T 4: 116,307,210 A1670T probably benign Het
Mtcl1 A T 17: 66,377,947 L949Q probably benign Het
Nlrp4a T C 7: 26,459,794 V833A probably benign Het
Olfr358 T C 2: 37,005,048 T189A probably benign Het
Olfr945 A T 9: 39,257,803 Y290N probably damaging Het
Osgep C A 14: 50,917,877 A75S probably damaging Het
Pank1 C A 19: 34,878,655 R141L probably benign Het
Pcdhb20 T A 18: 37,505,254 S278T probably benign Het
Pcdhgb8 C A 18: 37,763,312 F478L probably benign Het
Peg10 C CTCT 6: 4,756,453 probably benign Het
Polr2a G A 11: 69,735,486 P1613S probably benign Het
Prom2 A C 2: 127,539,204 S251A probably benign Het
R3hdm2 A G 10: 127,484,160 H546R probably damaging Het
Reck G T 4: 43,891,011 V50L probably benign Het
Rerg T C 6: 137,056,186 T164A probably benign Het
Rho T A 6: 115,935,385 probably null Het
Ric1 A G 19: 29,597,783 T959A probably damaging Het
Slc28a3 T A 13: 58,576,795 N215I possibly damaging Het
Slc2a5 G A 4: 150,125,662 V35I probably benign Het
Srpk2 A T 5: 23,513,988 S610T probably benign Het
Tmem147 T A 7: 30,728,231 M86L probably benign Het
Trhde A G 10: 114,800,717 V195A probably benign Het
Trio T C 15: 27,773,952 S112G possibly damaging Het
U2af2 T C 7: 5,075,694 V424A probably benign Het
Vmn2r27 T C 6: 124,224,241 I252M probably benign Het
Wasf2 A G 4: 133,185,101 E88G unknown Het
Zfp37 A G 4: 62,192,003 C275R probably damaging Het
Zfp532 A T 18: 65,624,066 I357F probably damaging Het
Other mutations in Il2rb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Il2rb APN 15 78481697 missense probably benign 0.00
Bonnerhall UTSW 15 78485004 missense probably benign
diptera UTSW 15 78485806 missense probably damaging 1.00
flybase UTSW 15 78491848 start codon destroyed probably null 0.66
Moonpie UTSW 15 78481834 frame shift probably null
Whistles UTSW 15 78481936 missense possibly damaging 0.72
R0581:Il2rb UTSW 15 78481936 missense possibly damaging 0.72
R1795:Il2rb UTSW 15 78483987 missense probably damaging 1.00
R1932:Il2rb UTSW 15 78491777 missense possibly damaging 0.93
R2924:Il2rb UTSW 15 78491849 start codon destroyed probably null 0.27
R4706:Il2rb UTSW 15 78486400 missense possibly damaging 0.81
R5713:Il2rb UTSW 15 78491848 start codon destroyed probably null 0.66
R5953:Il2rb UTSW 15 78484982 nonsense probably null
R6018:Il2rb UTSW 15 78482066 missense possibly damaging 0.54
R6279:Il2rb UTSW 15 78481538 missense possibly damaging 0.72
R6666:Il2rb UTSW 15 78481834 frame shift probably null
R6961:Il2rb UTSW 15 78485824 missense probably damaging 1.00
R8020:Il2rb UTSW 15 78485004 missense probably benign
X0018:Il2rb UTSW 15 78485765 missense probably damaging 1.00
X0066:Il2rb UTSW 15 78484956 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACTGATGTCTTGAGCATCCC -3'
(R):5'- GAAGAGGCTGTTTGCTTAGC -3'

Sequencing Primer
(F):5'- GAGCATCCCTGTCTCTGGTAAG -3'
(R):5'- AGCCTCTTGACCTCGTTGCG -3'
Posted On2021-01-18