Incidental Mutation 'R8477:Pcdhgb8'
ID 657337
Institutional Source Beutler Lab
Gene Symbol Pcdhgb8
Ensembl Gene ENSMUSG00000103081
Gene Name protocadherin gamma subfamily B, 8
Synonyms
MMRRC Submission 067921-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.168) question?
Stock # R8477 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 37894854-37973542 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 37896365 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 478 (F478L)
Ref Sequence ENSEMBL: ENSMUSP00000146671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003599] [ENSMUST00000044851] [ENSMUST00000061279] [ENSMUST00000066149] [ENSMUST00000073447] [ENSMUST00000091935] [ENSMUST00000115661] [ENSMUST00000192511] [ENSMUST00000192535] [ENSMUST00000192931] [ENSMUST00000193404] [ENSMUST00000193414] [ENSMUST00000193869] [ENSMUST00000194190] [ENSMUST00000194418] [ENSMUST00000194544] [ENSMUST00000194928] [ENSMUST00000208907] [ENSMUST00000195112] [ENSMUST00000195363] [ENSMUST00000195764] [ENSMUST00000195823]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000003599
SMART Domains Protein: ENSMUSP00000003599
Gene: ENSMUSG00000103088

DomainStartEndE-ValueType
CA 47 131 8.06e-6 SMART
CA 155 240 2.29e-19 SMART
CA 264 345 3.36e-26 SMART
CA 369 450 4.94e-24 SMART
CA 474 560 7.6e-25 SMART
CA 591 672 9.18e-10 SMART
Pfam:Cadherin_C_2 687 768 3.5e-20 PFAM
Pfam:Cadherin_tail 807 930 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044851
SMART Domains Protein: ENSMUSP00000036359
Gene: ENSMUSG00000102428

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
CA 45 131 3.28e-1 SMART
CA 155 240 1.8e-17 SMART
CA 264 345 9.22e-24 SMART
CA 369 450 1.28e-22 SMART
CA 474 560 1.09e-25 SMART
CA 591 669 9.24e-15 SMART
Pfam:Cadherin_C_2 688 772 3.6e-25 PFAM
Pfam:Cadherin_tail 809 932 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061279
SMART Domains Protein: ENSMUSP00000058362
Gene: ENSMUSG00000102742

DomainStartEndE-ValueType
CA 45 131 3.23e-2 SMART
CA 155 240 2.22e-17 SMART
CA 264 345 3.36e-26 SMART
CA 369 450 7.09e-25 SMART
CA 474 560 3.55e-25 SMART
CA 591 669 2.53e-12 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 914 933 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066149
SMART Domains Protein: ENSMUSP00000067728
Gene: ENSMUSG00000103897

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 31 131 4.84e-2 SMART
CA 155 240 1.48e-22 SMART
CA 264 345 1.14e-23 SMART
CA 369 450 9.44e-21 SMART
CA 474 560 1.03e-26 SMART
CA 591 669 3.64e-13 SMART
Pfam:Cadherin_C_2 688 772 3e-25 PFAM
Pfam:Cadherin_tail 809 932 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073447
SMART Domains Protein: ENSMUSP00000073150
Gene: ENSMUSG00000104346

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 42 128 2.15e-2 SMART
CA 152 237 4.8e-13 SMART
CA 261 342 9.36e-25 SMART
CA 366 447 6.62e-25 SMART
CA 471 557 6.72e-26 SMART
CA 588 666 2.15e-15 SMART
Pfam:Cadherin_C_2 685 768 4.8e-24 PFAM
Pfam:Cadherin_tail 805 928 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091935
SMART Domains Protein: ENSMUSP00000089555
Gene: ENSMUSG00000102440

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 32 132 8.37e-3 SMART
CA 156 241 5.51e-22 SMART
CA 265 346 8.27e-26 SMART
CA 370 451 1.4e-23 SMART
CA 475 561 2.97e-27 SMART
CA 592 670 1.18e-12 SMART
Pfam:Cadherin_C_2 688 772 3.9e-24 PFAM
Pfam:Cadherin_tail 809 932 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192511
SMART Domains Protein: ENSMUSP00000141704
Gene: ENSMUSG00000103472

DomainStartEndE-ValueType
CA 47 133 1.57e-2 SMART
CA 157 242 3.24e-19 SMART
CA 266 347 3.21e-23 SMART
CA 371 452 9.08e-23 SMART
CA 476 562 1.32e-24 SMART
CA 593 671 3.5e-15 SMART
transmembrane domain 694 716 N/A INTRINSIC
low complexity region 916 935 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192535
SMART Domains Protein: ENSMUSP00000142010
Gene: ENSMUSG00000103749

DomainStartEndE-ValueType
low complexity region 17 25 N/A INTRINSIC
CA 56 131 8e-3 SMART
CA 155 240 2.49e-20 SMART
CA 264 341 4.97e-29 SMART
CA 365 446 1.09e-25 SMART
CA 470 556 1.75e-24 SMART
CA 587 668 9.18e-10 SMART
transmembrane domain 687 709 N/A INTRINSIC
low complexity region 907 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192931
SMART Domains Protein: ENSMUSP00000141348
Gene: ENSMUSG00000103037

DomainStartEndE-ValueType
CA 36 119 8e-3 SMART
CA 143 228 1.34e-20 SMART
CA 252 333 1.52e-24 SMART
CA 357 438 9.22e-24 SMART
CA 462 548 1.24e-24 SMART
CA 579 660 1.3e-9 SMART
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193404
SMART Domains Protein: ENSMUSP00000141359
Gene: ENSMUSG00000102222

DomainStartEndE-ValueType
CA 43 129 2.76e-2 SMART
CA 153 238 1.16e-20 SMART
CA 262 343 1.25e-25 SMART
CA 367 448 4.75e-26 SMART
CA 472 558 3.69e-23 SMART
CA 589 667 3.84e-12 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193414
SMART Domains Protein: ENSMUSP00000141893
Gene: ENSMUSG00000103567

DomainStartEndE-ValueType
CA 45 131 2.45e-1 SMART
CA 155 240 1.05e-18 SMART
CA 264 345 6.52e-24 SMART
CA 369 450 5.99e-23 SMART
CA 474 560 6.99e-24 SMART
CA 591 669 5.31e-15 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193869
SMART Domains Protein: ENSMUSP00000141482
Gene: ENSMUSG00000103332

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 45 131 1.64e-2 SMART
CA 155 240 6.42e-23 SMART
CA 264 345 1.76e-20 SMART
CA 369 450 2.27e-23 SMART
CA 474 560 1.5e-23 SMART
CA 591 669 1.17e-16 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194190
SMART Domains Protein: ENSMUSP00000142062
Gene: ENSMUSG00000103144

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 3.16e-2 SMART
CA 155 240 5.39e-16 SMART
CA 264 345 6.72e-26 SMART
CA 369 450 1.32e-24 SMART
CA 474 560 4.17e-22 SMART
CA 591 669 4.48e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194418
SMART Domains Protein: ENSMUSP00000142140
Gene: ENSMUSG00000103677

DomainStartEndE-ValueType
CA 44 130 1.64e-2 SMART
CA 154 239 3.93e-18 SMART
CA 263 344 5.22e-23 SMART
CA 368 449 5.02e-25 SMART
CA 473 559 2.07e-26 SMART
CA 590 668 6.84e-18 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194928
SMART Domains Protein: ENSMUSP00000141997
Gene: ENSMUSG00000104063

DomainStartEndE-ValueType
CA 47 131 2.48e-6 SMART
CA 155 240 1.57e-17 SMART
CA 264 343 1.29e-27 SMART
CA 367 448 9.14e-28 SMART
CA 472 558 1.24e-24 SMART
CA 589 670 3.73e-10 SMART
transmembrane domain 689 711 N/A INTRINSIC
low complexity region 716 721 N/A INTRINSIC
low complexity region 910 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208907
AA Change: F478L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000195112
SMART Domains Protein: ENSMUSP00000141449
Gene: ENSMUSG00000102748

DomainStartEndE-ValueType
CA 24 130 8.18e-3 SMART
CA 154 239 1.39e-18 SMART
CA 263 344 7.91e-23 SMART
CA 368 449 2.27e-23 SMART
CA 473 559 1.24e-24 SMART
CA 590 671 1.3e-9 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195363
SMART Domains Protein: ENSMUSP00000142227
Gene: ENSMUSG00000103585

DomainStartEndE-ValueType
low complexity region 17 25 N/A INTRINSIC
CA 56 131 1.47e-2 SMART
CA 155 240 1.23e-19 SMART
CA 264 343 5.54e-27 SMART
CA 367 448 5.09e-26 SMART
CA 472 558 1.98e-23 SMART
CA 589 670 1.3e-9 SMART
transmembrane domain 689 711 N/A INTRINSIC
low complexity region 893 912 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000142272
Gene: ENSMUSG00000103081
AA Change: F478L

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 57 132 1.5e-4 SMART
CA 156 241 1.2e-20 SMART
CA 265 346 7.8e-29 SMART
CA 370 451 1.7e-26 SMART
CA 475 561 2.2e-26 SMART
CA 592 673 6.4e-12 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195823
SMART Domains Protein: ENSMUSP00000141803
Gene: ENSMUSG00000103793

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
CA 45 131 2.41e-2 SMART
CA 155 240 5.77e-16 SMART
CA 264 345 1.1e-21 SMART
CA 369 450 2.75e-22 SMART
low complexity region 453 462 N/A INTRINSIC
CA 474 560 9.22e-24 SMART
CA 591 669 2.4e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 78,924,174 (GRCm39) S94L probably benign Het
Ackr1 C T 1: 173,159,755 (GRCm39) G255R probably damaging Het
Aldh1l2 G A 10: 83,337,785 (GRCm39) T560I probably damaging Het
Arhgef25 A T 10: 127,020,266 (GRCm39) F384I probably damaging Het
Bptf T A 11: 106,943,679 (GRCm39) Q2671L probably damaging Het
Ccdc159 A G 9: 21,844,223 (GRCm39) E95G probably damaging Het
Cenpf A T 1: 189,385,385 (GRCm39) H2298Q probably benign Het
Chn2 G T 6: 54,246,467 (GRCm39) probably null Het
Csnk1g1 T C 9: 65,909,555 (GRCm39) L224P probably damaging Het
Cyp2c54 T A 19: 40,058,708 (GRCm39) K241N probably benign Het
Cyp2c55 G T 19: 38,999,485 (GRCm39) V64L probably damaging Het
Dlgap1 A C 17: 70,823,967 (GRCm39) Q317H probably damaging Het
Dnaja3 A G 16: 4,505,212 (GRCm39) D108G probably null Het
Dpagt1 G T 9: 44,243,390 (GRCm39) probably null Het
Dzip1 T C 14: 119,138,958 (GRCm39) R424G possibly damaging Het
Ero1b A G 13: 12,616,672 (GRCm39) K367R probably benign Het
Evi2 T C 11: 79,406,891 (GRCm39) Y228C probably benign Het
Exosc10 A T 4: 148,649,847 (GRCm39) I426L possibly damaging Het
Gba2 C T 4: 43,569,944 (GRCm39) R423Q probably damaging Het
Gm19965 A C 1: 116,730,854 (GRCm39) probably benign Het
Gpr165 C A X: 95,757,623 (GRCm39) D7E probably benign Het
Gvin2 T C 7: 105,548,133 (GRCm39) K1640E possibly damaging Het
Hc A T 2: 34,879,182 (GRCm39) C1557S probably damaging Het
Hfm1 C T 5: 107,029,684 (GRCm39) S799N probably benign Het
Hibadh A T 6: 52,617,185 (GRCm39) W17R probably benign Het
Hivep1 A T 13: 42,337,696 (GRCm39) T2592S probably benign Het
Ighv8-5 G A 12: 115,031,200 (GRCm39) T113I probably benign Het
Il2rb A T 15: 78,370,006 (GRCm39) V211D probably damaging Het
Itgal A G 7: 126,900,105 (GRCm39) Y121C probably damaging Het
Kirrel1 T C 3: 86,992,138 (GRCm39) T597A possibly damaging Het
Lats1 A G 10: 7,581,279 (GRCm39) E688G probably damaging Het
Lbr C T 1: 181,644,539 (GRCm39) A589T possibly damaging Het
Limch1 G A 5: 67,131,908 (GRCm39) V133I probably benign Het
Mast2 C T 4: 116,164,407 (GRCm39) A1670T probably benign Het
Mtcl1 A T 17: 66,684,942 (GRCm39) L949Q probably benign Het
Nlrp4a T C 7: 26,159,219 (GRCm39) V833A probably benign Het
Or12k5 T C 2: 36,895,060 (GRCm39) T189A probably benign Het
Or8g28 A T 9: 39,169,099 (GRCm39) Y290N probably damaging Het
Osgep C A 14: 51,155,334 (GRCm39) A75S probably damaging Het
Pank1 C A 19: 34,856,055 (GRCm39) R141L probably benign Het
Pcdhb20 T A 18: 37,638,307 (GRCm39) S278T probably benign Het
Peg10 C CTCT 6: 4,756,453 (GRCm39) probably benign Het
Polr2a G A 11: 69,626,312 (GRCm39) P1613S probably benign Het
Pramel55 A C 5: 95,949,567 (GRCm39) M105L probably benign Het
Prom2 A C 2: 127,381,124 (GRCm39) S251A probably benign Het
R3hdm2 A G 10: 127,320,029 (GRCm39) H546R probably damaging Het
Reck G T 4: 43,891,011 (GRCm39) V50L probably benign Het
Rerg T C 6: 137,033,184 (GRCm39) T164A probably benign Het
Rho T A 6: 115,912,346 (GRCm39) probably null Het
Ric1 A G 19: 29,575,183 (GRCm39) T959A probably damaging Het
Slc28a3 T A 13: 58,724,609 (GRCm39) N215I possibly damaging Het
Slc2a5 G A 4: 150,210,119 (GRCm39) V35I probably benign Het
Srpk2 A T 5: 23,718,986 (GRCm39) S610T probably benign Het
Tasor2 A G 13: 3,625,079 (GRCm39) F1624L probably benign Het
Tmem147 T A 7: 30,427,656 (GRCm39) M86L probably benign Het
Trhde A G 10: 114,636,622 (GRCm39) V195A probably benign Het
Trio T C 15: 27,774,038 (GRCm39) S112G possibly damaging Het
U2af2 T C 7: 5,078,693 (GRCm39) V424A probably benign Het
Vmn2r27 T C 6: 124,201,200 (GRCm39) I252M probably benign Het
Wasf2 A G 4: 132,912,412 (GRCm39) E88G unknown Het
Zfp37 A G 4: 62,110,240 (GRCm39) C275R probably damaging Het
Zfp532 A T 18: 65,757,137 (GRCm39) I357F probably damaging Het
Other mutations in Pcdhgb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Pcdhgb8 APN 18 37,958,089 (GRCm39) missense probably damaging 1.00
R0011:Pcdhgb8 UTSW 18 37,897,335 (GRCm39) missense probably benign 0.03
R2763:Pcdhgb8 UTSW 18 37,895,315 (GRCm39) missense probably damaging 1.00
R3797:Pcdhgb8 UTSW 18 37,895,728 (GRCm39) missense probably benign 0.00
R3926:Pcdhgb8 UTSW 18 37,895,443 (GRCm39) missense probably damaging 1.00
R4012:Pcdhgb8 UTSW 18 37,896,414 (GRCm39) missense probably benign 0.32
R4167:Pcdhgb8 UTSW 18 37,895,596 (GRCm39) missense possibly damaging 0.82
R4183:Pcdhgb8 UTSW 18 37,896,594 (GRCm39) missense probably damaging 1.00
R4190:Pcdhgb8 UTSW 18 37,896,594 (GRCm39) missense probably damaging 1.00
R4191:Pcdhgb8 UTSW 18 37,896,594 (GRCm39) missense probably damaging 1.00
R4192:Pcdhgb8 UTSW 18 37,896,594 (GRCm39) missense probably damaging 1.00
R4193:Pcdhgb8 UTSW 18 37,896,594 (GRCm39) missense probably damaging 1.00
R4441:Pcdhgb8 UTSW 18 37,896,114 (GRCm39) missense possibly damaging 0.84
R4585:Pcdhgb8 UTSW 18 37,895,413 (GRCm39) missense probably benign 0.24
R4762:Pcdhgb8 UTSW 18 37,895,419 (GRCm39) missense probably damaging 1.00
R4917:Pcdhgb8 UTSW 18 37,897,191 (GRCm39) missense probably damaging 1.00
R5825:Pcdhgb8 UTSW 18 37,895,289 (GRCm39) missense probably benign 0.03
R5992:Pcdhgb8 UTSW 18 37,896,502 (GRCm39) missense probably damaging 1.00
R6034:Pcdhgb8 UTSW 18 37,895,601 (GRCm39) missense possibly damaging 0.54
R6034:Pcdhgb8 UTSW 18 37,895,601 (GRCm39) missense possibly damaging 0.54
R6346:Pcdhgb8 UTSW 18 37,895,131 (GRCm39) missense probably damaging 1.00
R6800:Pcdhgb8 UTSW 18 37,896,580 (GRCm39) missense probably benign 0.40
R6833:Pcdhgb8 UTSW 18 37,895,142 (GRCm39) missense probably benign 0.14
R6834:Pcdhgb8 UTSW 18 37,895,142 (GRCm39) missense probably benign 0.14
R7032:Pcdhgb8 UTSW 18 37,896,962 (GRCm39) missense probably benign 0.00
R7035:Pcdhgb8 UTSW 18 37,896,201 (GRCm39) missense possibly damaging 0.93
R7145:Pcdhgb8 UTSW 18 37,896,050 (GRCm39) nonsense probably null
R7165:Pcdhgb8 UTSW 18 37,896,231 (GRCm39) missense possibly damaging 0.82
R7240:Pcdhgb8 UTSW 18 37,896,756 (GRCm39) missense probably damaging 0.99
R7314:Pcdhgb8 UTSW 18 37,896,052 (GRCm39) missense probably damaging 1.00
R7463:Pcdhgb8 UTSW 18 37,896,480 (GRCm39) missense probably damaging 1.00
R7922:Pcdhgb8 UTSW 18 37,897,002 (GRCm39) missense probably benign 0.00
R8052:Pcdhgb8 UTSW 18 37,896,555 (GRCm39) missense probably benign 0.00
R8826:Pcdhgb8 UTSW 18 37,895,301 (GRCm39) missense probably damaging 1.00
R8885:Pcdhgb8 UTSW 18 37,896,177 (GRCm39) missense possibly damaging 0.58
R9095:Pcdhgb8 UTSW 18 37,896,052 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTAACAGATGGGATCCTGGAC -3'
(R):5'- TCGAGTGTGGGATACAGCAC -3'

Sequencing Primer
(F):5'- GAGCAGACTCCAGAGTACAACGTC -3'
(R):5'- TGGGATACAGCACGCGTG -3'
Posted On 2021-01-18