Incidental Mutation 'R0440:Zfp748'
ID65734
Institutional Source Beutler Lab
Gene Symbol Zfp748
Ensembl Gene ENSMUSG00000095432
Gene Namezinc finger protein 748
Synonyms2610014M12Rik, mszf54, Zfp208, KRAB-O
MMRRC Submission 038641-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R0440 (G1)
Quality Score28
Status Validated (trace)
Chromosome13
Chromosomal Location67538641-67553830 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to C at 67553025 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000181892]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000053289
SMART Domains Protein: ENSMUSP00000080439
Gene: ENSMUSG00000095432

DomainStartEndE-ValueType
KRAB 5 65 3.39e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180908
Predicted Effect probably null
Transcript: ENSMUST00000181892
SMART Domains Protein: ENSMUSP00000137928
Gene: ENSMUSG00000095432

DomainStartEndE-ValueType
KRAB 5 65 3.39e-35 SMART
ZnF_C2H2 81 101 1.59e1 SMART
low complexity region 133 144 N/A INTRINSIC
ZnF_C2H2 165 187 5.14e-3 SMART
ZnF_C2H2 193 215 2.71e-2 SMART
ZnF_C2H2 277 298 7.37e1 SMART
ZnF_C2H2 304 326 1.95e-3 SMART
ZnF_C2H2 332 354 8.94e-3 SMART
ZnF_C2H2 360 382 2.61e-4 SMART
ZnF_C2H2 388 410 5.9e-3 SMART
ZnF_C2H2 416 438 3.44e-4 SMART
ZnF_C2H2 444 466 3.89e-3 SMART
ZnF_C2H2 472 494 4.79e-3 SMART
ZnF_C2H2 500 522 1.6e-4 SMART
ZnF_C2H2 528 550 1.18e-2 SMART
ZnF_C2H2 556 578 1.12e-3 SMART
ZnF_C2H2 584 606 3.89e-3 SMART
ZnF_C2H2 612 634 2.95e-3 SMART
ZnF_C2H2 640 662 1.6e-4 SMART
ZnF_C2H2 668 690 2.95e-3 SMART
ZnF_C2H2 696 718 2.12e-4 SMART
ZnF_C2H2 724 746 4.47e-3 SMART
ZnF_C2H2 752 774 1.12e-3 SMART
ZnF_C2H2 780 802 3.89e-3 SMART
ZnF_C2H2 808 830 1.47e-3 SMART
ZnF_C2H2 836 858 4.87e-4 SMART
ZnF_C2H2 864 886 7.9e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224521
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224664
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt G A 15: 83,228,493 R30W probably damaging Het
Adam7 T C 14: 68,510,856 probably null Het
Agl A T 3: 116,758,806 L1158Q probably damaging Het
Akap9 T C 5: 4,064,569 S66P probably damaging Het
Akr1c20 T A 13: 4,487,208 D316V probably benign Het
App C A 16: 85,056,414 E259* probably null Het
Arhgef4 A G 1: 34,745,448 probably null Het
Armc9 G A 1: 86,194,262 probably null Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Btaf1 C T 19: 36,986,653 P875S probably damaging Het
Cc2d1b T A 4: 108,625,816 probably null Het
Ccar1 C T 10: 62,780,457 V165I possibly damaging Het
Ccdc106 A T 7: 5,060,245 I250F probably damaging Het
Ccny T C 18: 9,332,917 I205V probably benign Het
Cfap52 T A 11: 67,954,088 I52L probably benign Het
Chd8 T A 14: 52,204,826 T2096S possibly damaging Het
Clstn3 G A 6: 124,451,413 T423I probably damaging Het
Col13a1 T C 10: 61,867,483 D440G possibly damaging Het
Dclk3 G A 9: 111,469,163 V592M probably damaging Het
Ddx31 A T 2: 28,857,132 I208F probably damaging Het
Dlat A T 9: 50,645,119 probably null Het
Eml4 T C 17: 83,446,058 probably null Het
Enpp2 T A 15: 54,847,237 probably benign Het
Fryl T C 5: 73,086,972 S38G possibly damaging Het
Gcnt1 G A 19: 17,330,316 T15I probably benign Het
Gm21834 T C 17: 57,742,126 T32A possibly damaging Het
Golga2 A G 2: 32,302,933 D394G probably damaging Het
Gtf3c4 G T 2: 28,840,169 probably null Het
Igkv4-69 A G 6: 69,284,269 probably benign Het
Inpp5j T C 11: 3,501,150 R500G possibly damaging Het
Kif5b A T 18: 6,226,980 probably benign Het
Klhl36 A G 8: 119,876,551 E515G probably damaging Het
Lifr C T 15: 7,157,191 R59* probably null Het
Lrif1 A T 3: 106,734,398 Q10L possibly damaging Het
Lrp8 A G 4: 107,869,098 E908G probably damaging Het
Lrrc23 A T 6: 124,770,704 D307E probably benign Het
Mpv17l T C 16: 13,944,719 F27L probably damaging Het
Mta3 C T 17: 83,766,587 A76V probably damaging Het
Muc5ac T A 7: 141,792,034 Y202* probably null Het
Naprt A G 15: 75,891,069 probably benign Het
Npr2 T A 4: 43,650,315 V960D probably damaging Het
Oca2 A T 7: 56,423,352 Y765F probably benign Het
Olfr715 A T 7: 107,128,732 H220Q probably benign Het
Plxna2 T A 1: 194,644,404 Y215* probably null Het
Prdm16 G A 4: 154,476,627 probably benign Het
Ptn A G 6: 36,744,497 S3P probably benign Het
Pus10 T C 11: 23,673,331 probably benign Het
Rad21 A T 15: 51,968,358 D442E probably benign Het
Rmdn2 A G 17: 79,667,955 H291R probably damaging Het
Rp1 A G 1: 4,345,640 S1750P probably damaging Het
Samd4b A T 7: 28,408,160 I228N probably benign Het
Sdr9c7 G T 10: 127,898,953 probably benign Het
Slc13a2 T C 11: 78,403,175 N254D probably benign Het
Slc16a8 T A 15: 79,252,607 I132F probably damaging Het
Slc18b1 T A 10: 23,819,078 Y274N probably benign Het
Slc45a2 A T 15: 11,000,817 M1L probably benign Het
Smc1b A G 15: 85,112,673 probably benign Het
Stab2 T C 10: 86,949,928 S617G probably benign Het
Stk10 A G 11: 32,604,190 M626V probably damaging Het
Synpo2l T G 14: 20,661,398 I385L possibly damaging Het
Tmprss11d T C 5: 86,338,812 Y73C probably damaging Het
Ttc21b A G 2: 66,236,382 V309A probably benign Het
Tubgcp6 A G 15: 89,103,065 I1235T probably benign Het
Usp8 A G 2: 126,725,390 I110V probably benign Het
Vps13c G A 9: 67,972,861 G3442S probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Zfp207 T A 11: 80,395,507 probably benign Het
Other mutations in Zfp748
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02366:Zfp748 APN 13 67545427 splice site probably benign
R0790:Zfp748 UTSW 13 67545362 missense probably benign 0.03
R1760:Zfp748 UTSW 13 67545421 critical splice acceptor site probably null
R2520:Zfp748 UTSW 13 67546662 missense possibly damaging 0.84
R3711:Zfp748 UTSW 13 67540796 missense probably damaging 1.00
R4157:Zfp748 UTSW 13 67542106 missense possibly damaging 0.80
R4288:Zfp748 UTSW 13 67541083 missense probably damaging 1.00
R4289:Zfp748 UTSW 13 67541083 missense probably damaging 1.00
R5091:Zfp748 UTSW 13 67541519 missense probably damaging 1.00
R5441:Zfp748 UTSW 13 67540618 missense probably damaging 1.00
R5686:Zfp748 UTSW 13 67542528 nonsense probably null
R5907:Zfp748 UTSW 13 67541173 missense possibly damaging 0.87
R6210:Zfp748 UTSW 13 67540804 missense possibly damaging 0.85
R6268:Zfp748 UTSW 13 67542586 missense possibly damaging 0.77
R6639:Zfp748 UTSW 13 67542905 missense probably damaging 1.00
R6810:Zfp748 UTSW 13 67541725 missense probably damaging 1.00
R7148:Zfp748 UTSW 13 67542239 missense possibly damaging 0.96
R7464:Zfp748 UTSW 13 67541972 missense probably damaging 1.00
R7593:Zfp748 UTSW 13 67542519 missense probably benign 0.20
R7644:Zfp748 UTSW 13 67541449 missense probably damaging 0.99
R7799:Zfp748 UTSW 13 67541489 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGTATGAGTCCACCACCACCACTTC -3'
(R):5'- GTAGTCTTCCGTTGGATCGCTTCAC -3'

Sequencing Primer
(F):5'- CACTTCCAGGTACAGGTTACGAG -3'
(R):5'- GCTTCACAAGGAGCCATTG -3'
Posted On2013-08-09